Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Rattus norvegicus
Genetic Insert: ATP6-W68-R17 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG
Proper citation: RRID:Addgene_198839 Copy
Species: Rattus norvegicus
Genetic Insert: Shank2
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This is a validated antigen plasmid of Anti-Pan-Shank [N23B/49R].
Proper citation: RRID:Addgene_197334 Copy
Species: Rattus norvegicus
Genetic Insert: Kv1.4
Vector Backbone Description: Vector Backbone:RBG4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This is a validated antigen plasmid of Anti-Kv1.4 K+ channel [K13/31R].
Proper citation: RRID:Addgene_197331 Copy
Species: Rattus norvegicus
Genetic Insert: Synaptotagmin 12
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4006; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22398727
Comments: The first codon of the Synpatotagmin has been removed
Proper citation: RRID:Addgene_184513 Copy
Species: Rattus norvegicus
Genetic Insert: Nedd1-mNeonGreen
Vector Backbone Description: Backbone Size:6789; Vector Backbone:pBeta-actin-Tubg1-mNeonGreen ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36796357
Proper citation: RRID:Addgene_196864 Copy
Species: Rattus norvegicus
Genetic Insert: Halo-Tag-Akap9 (128-425)
Vector Backbone Description: Backbone Size:4998; Vector Backbone:pCAG-lox; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36796357
Proper citation: RRID:Addgene_196873 Copy
Species: Rattus norvegicus
Genetic Insert: AcGFP-Cdk5rap2-CTDdeltaCBD
Vector Backbone Description: Backbone Size:6748; Vector Backbone:pBeta-actin-AcGFP-CI ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36796357
Comments: Lacking the centrosome-binding domain (CBD): VITHQVLRKA
Proper citation: RRID:Addgene_196856 Copy
Species: Rattus norvegicus
Genetic Insert: 2xHA-Akap9(128-425)
Vector Backbone Description: Backbone Size:7546; Vector Backbone:pCAG-lox; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36796357
Proper citation: RRID:Addgene_196897 Copy
Species: Rattus norvegicus
Genetic Insert: Map1lc3b
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3900; Vector Backbone:pEGFPc; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37133994
Proper citation: RRID:Addgene_200431 Copy
Species: Rattus norvegicus
Genetic Insert: GIT1
Vector Backbone Description: Vector Backbone:pBk; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: This is a validated antigen plasmid of Anti-GIT1 [N39B/8R].
Proper citation: RRID:Addgene_197313 Copy
Species: Rattus norvegicus
Genetic Insert: Cav3.1
Vector Backbone Description: Backbone Marker:#45811 (alt); Vector Backbone:pcDNA3-HE3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This is a validated antigen plasmid of Anti-Cav3.1 Ca2+ channel [N178A/9.1R].
Proper citation: RRID:Addgene_197324 Copy
Species: Rattus norvegicus
Genetic Insert: upstream KCNB2 promoter gRNA
Vector Backbone Description: Backbone Marker:Bagli Lab; Backbone Size:4044; Vector Backbone:CMV+Puro_B52; Vector Types:Mammalian Expression, gRNA with puromycin selection; Bacterial Resistance:Ampicillin
Comments: Any publications using this clone should state: "we thank the laboratory of Darius Bagli for the use of this clone". In addition, we have a forthcoming article which can be referenced once it is published.
Proper citation: RRID:Addgene_197558 Copy
Species: Rattus norvegicus
Genetic Insert: AP-2 αC
Vector Backbone Description: Backbone Size:7987; Vector Backbone:pGADT7; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21097499
Proper citation: RRID:Addgene_197650 Copy
Species: Rattus norvegicus
Genetic Insert: SYT1 and HaloTag
Vector Backbone Description: Vector Backbone:FUGW (#14883); Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36729040
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.02.08.479521v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_197275 Copy
Species: Rattus norvegicus
Genetic Insert: Streptavidin
Vector Backbone Description: Vector Backbone:FUGW (#14883); Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36729040
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.02.08.479521v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_197277 Copy
Species: Rattus norvegicus
Genetic Insert: SYB2 and HaloTag
Vector Backbone Description: Vector Backbone:pEF (#11154); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36729040
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.02.08.479521v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_197282 Copy
Species: Rattus norvegicus
Genetic Insert: SYT1 and HaloTag
Vector Backbone Description: Vector Backbone:pEF (#11154); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36729040
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.02.08.479521v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_197280 Copy
Species: Rattus norvegicus
Genetic Insert: GluR1-Flop
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This is a validated antigen plasmid of Anti-GluA1/GluR1 glutamate receptor [N355/1R].
Proper citation: RRID:Addgene_197308 Copy
Species: Rattus norvegicus
Genetic Insert: UNC13A
Vector Backbone Description: Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: The depositor confirms that discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences. Addgene NGS finds a silent mutation S1296 and I989S in Munc13-1.
Proper citation: RRID:Addgene_245006 Copy
Species: Rattus norvegicus
Genetic Insert: Rab3a
Vector Backbone Description: Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: The depositor confirms that discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences. Compared to the depositor reference sequence, Addgene NGS finds alternate codons in mNeongreen, a 5-amino-acid addition to the linker, and a 13-amino-acid deletion from the linker upstream of Rab3Q81L.
Proper citation: RRID:Addgene_245012 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
