Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 5 showing 81 ~ 100 out of 740,833 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/238752

Species: Homo sapiens
Genetic Insert: VHL
Vector Backbone Description: Vector Backbone:pFC221K HaloTag(R) CMV-Blast BiBRET Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_238752 Copy   


http://www.addgene.org/238750

Species: Homo sapiens
Genetic Insert: PSMD3
Vector Backbone Description: Vector Backbone:pFN21A HaloTag(R) CMV Flexi(R) Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_238750 Copy   


http://www.addgene.org/236898

Species: Homo sapiens
Genetic Insert: CHRM1
Vector Backbone Description: Vector Backbone:pBiT3.1-N [CMV/HiBiT/Blast] Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_236898 Copy   


http://www.addgene.org/236699

Species: Homo sapiens
Genetic Insert: PXDN
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pAAV-hSyn-EGFP; Vector Types:AAV, Cre/Lox; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_236699 Copy   


http://www.addgene.org/236698

Species: Homo sapiens
Genetic Insert: PXDN
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pAAV-hSyn-EGFP; Vector Types:AAV; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_236698 Copy   


http://www.addgene.org/236703

Species: Homo sapiens
Genetic Insert: CECR2
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pAAV-hSyn-EGFP; Vector Types:AAV, Cre/Lox; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_236703 Copy   


http://www.addgene.org/236713

Species: Homo sapiens
Genetic Insert: CUL7
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pAAV-hSyn-EGFP; Vector Types:AAV, Cre/Lox; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_236713 Copy   


http://www.addgene.org/236712

Species: Homo sapiens
Genetic Insert: CUL7
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pAAV-hSyn-EGFP; Vector Types:AAV; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_236712 Copy   


http://www.addgene.org/238826

Species: Homo sapiens
Genetic Insert: MAVS
Vector Backbone Description: Vector Backbone:pFN224C NanoLuc(R) CMV-Neo BiBRET-Balanced Vector and pFN222K HaloTag(R) CMV-Blast BiBRET Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_238826 Copy   


http://www.addgene.org/237150

Species: Homo sapiens
Genetic Insert: IRF5
Vector Backbone Description: Vector Backbone:pFN31K Nluc CMV-neo Flexi(R) Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_237150 Copy   


http://www.addgene.org/238353

Species: Mus musculus
Genetic Insert: Microexon E35a
Vector Backbone Description: Vector Backbone:pCAGGS; Vector Types:Mammalian Expression, Other, TOPO TA vector; Bacterial Resistance:Ampicillin
Comments: Microexon E35a sequence: gagacagagtcagatcaagatgatgag

Proper citation: RRID:Addgene_238353 Copy   


  • RRID:Addgene_155845

http://www.addgene.org/155845

Species: Homo sapiens
Genetic Insert: PRMT1
Vector Backbone Description: Backbone Size:7357; Vector Backbone:E2.pEF5-DEST-FL-V5-MCP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_155845 Copy   


http://www.addgene.org/148142

Species: Homo sapiens
Genetic Insert: HshnRNPH1
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.

Proper citation: RRID:Addgene_148142 Copy   


http://www.addgene.org/148586

Species: Homo sapiens
Genetic Insert: Hs4EHP-W95A
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28698298
Comments: ORF extracted from NCBI:NM_004846 or UniProt.: O60573-1 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.

Proper citation: RRID:Addgene_148586 Copy   


  • RRID:Addgene_225570

http://www.addgene.org/225570

Vector Backbone Description: Backbone Marker:Naldini group; Vector Backbone:pMDLg.pRRE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39804967
Comments: Please visit https://ssrn.com/abstract=4912248 for preprint.

Proper citation: RRID:Addgene_225570 Copy   


http://www.addgene.org/230597

Species: Synthetic
Genetic Insert: FlpO
Vector Backbone Description: Vector Backbone:pAAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38915722

Proper citation: RRID:Addgene_230597 Copy   


http://www.addgene.org/230596

Species: Synthetic
Genetic Insert: FlpO
Vector Backbone Description: Vector Backbone:pAAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38915722

Proper citation: RRID:Addgene_230596 Copy   


  • RRID:Addgene_187552

http://www.addgene.org/187552

Vector Backbone Description: Vector Backbone:pSB; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:32161816

Proper citation: RRID:Addgene_187552 Copy   


  • RRID:Addgene_187543

http://www.addgene.org/187543

Vector Backbone Description: Vector Backbone:pCA; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32161816

Proper citation: RRID:Addgene_187543 Copy   


  • RRID:Addgene_187549

http://www.addgene.org/187549

Vector Backbone Description: Vector Backbone:pCO; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32161816

Proper citation: RRID:Addgene_187549 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X