Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:saccharomyces cerevisiae (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

4,486 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pTH738-CENBEVYslow
 
Resource Report
Resource Website 		RRID:Addgene_38220 GCN4-based single uORF-containing 5'-UTR Saccharomyces cerevisiae Ampicillin PMID:24357599 Backbone Size:6614; Vector Backbone:pCENBEVY-U; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin The start codons of uORFs2, 3 and4 of the yeast Gcn4 leader sequence were mutated to non-start codons. 2026-08-15 01:14:20 0
pGEX-6P-1 Stu2 1-590
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_38314 5' 1770 bp from STU2 ORF Saccharomyces cerevisiae Ampicillin PMID:22993214 Backbone Marker:GE healthcare; Backbone Size:4984; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:21 4
pGEX-6P-1 Stu2 1-306
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_38315 5' 918 bp from STU2 ORF Saccharomyces cerevisiae Ampicillin PMID:22993214 Backbone Marker:GE healthcare; Backbone Size:4984; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:21 1
pKM263-ScPPX
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_38327 PPX1 Saccharomyces cerevisiae Ampicillin PMID:16184370 Backbone Marker:K. Melcher; Vector Backbone:pKM263; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:21 2
pET28b(+)_S. cerevisiae Hbs1(162-611)
 
Resource Report
Resource Website 		RRID:Addgene_39337 Elongation factor 1 alpha-like protein Saccharomyces cerevisiae Kanamycin Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:27 0
pET28b(+)_S. cerevisiae Hbs1(1-611)
 
Resource Report
Resource Website 		RRID:Addgene_39336 Elongation factor 1 alpha-like protein Saccharomyces cerevisiae Kanamycin Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:27 0
pET28b(+)_S. cerevisiae Hbs1(166-611)
 
Resource Report
Resource Website 		RRID:Addgene_39338 Elongation factor 1 alpha-like protein Saccharomyces cerevisiae Kanamycin Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:27 0
pTK93_Lifeact-mCherry
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46357 Lifeact Saccharomyces cerevisiae Ampicillin PMID:23870127 Backbone Size:5000; Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:31 9
pSNR52-sgTET
 
Resource Report
Resource Website 		RRID:Addgene_46923 sgRNA targeting endogenous TRE elements of pTET07 promoter Saccharomyces cerevisiae Ampicillin PMID:23849981 gRNA target sequence TATCAGTGATAGAGAAAAGT Backbone Size:5083; Vector Backbone:AH057; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 0
pJBEI-6410
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47049 Codon-optimized sequences for MEV pathway expression in E. coli to produce limonene Saccharomyces cerevisiae Ampicillin PMID:23727191 The R364S mutation in the MK is not known to alter the function. The plasmid functions as described in the associated publication. Backbone Size:3500; Vector Backbone:pBbA5a; Vector Types:Bacterial Expression, Synthetic Biology, BglBrick; Bacterial Resistance:Ampicillin R364S mutation in MK 2026-08-15 01:15:37 2
mito-BFP
 
Resource Report
Resource Website
50+ mentions 		RRID:Addgene_49151 mitochondrial targeting signal Saccharomyces cerevisiae Kanamycin PMID:21885730 Backbone Marker:Clontech; Vector Backbone:pAcGFP1-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:56 59
GFP-ATG8(416)/GFP-AUT7(416)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_49425 autophagy-related 8 Saccharomyces cerevisiae Ampicillin PMID:11739783 Backbone Size:4898; Vector Backbone:pRS416; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:00 8
GFP-ATG8(414)/GFP-AUT7(414)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_49424 autophagy-related 8 Saccharomyces cerevisiae Ampicillin PMID:12589048 Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:59 1
CuGFP-ATG8(416)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_49423 autophagy-related 8 Saccharomyces cerevisiae Ampicillin PMID:22977244 Backbone Size:4898; Vector Backbone:pRS416; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:59 5
pBIS-GALkFLP(Trp1)
 
Resource Report
Resource Website 		RRID:Addgene_49459 Flp(H305L) Saccharomyces cerevisiae Ampicillin PMID:9818722 This plasmid expresses a Flp ‘step-arrest’ mutant, Flp H305L, which carries out the first step of recombination, DNA cleavage, but fails to accomplish subsequent strand exchange and religation (Parsons et al.,1988). Backbone Marker:Stratagene; Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin H305L, ‘step-arrest’ mutant, 2026-08-15 01:16:00 0
pDR-meptrac-H194E
 
Resource Report
Resource Website 		RRID:Addgene_47764 MepTrac-H194E Saccharomyces cerevisiae Ampicillin PMID:23840931 Backbone Size:6000; Vector Backbone:pDR GW; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin H194E 2026-08-15 01:15:44 0
pDR-meptrac
 
Resource Report
Resource Website 		RRID:Addgene_47768 meptrac Saccharomyces cerevisiae Ampicillin PMID:23840931 Backbone Size:6000; Vector Backbone:pDR GW; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:45 0
IpO
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_48233 URA3 3' fragment Saccharomyces cerevisiae Ampicillin PMID:24604451 Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin URA3 ORF from +216 to 80 bp downstream of the stop codon 2026-08-15 01:15:48 1
pJH104
 
Resource Report
Resource Website 		RRID:Addgene_48262 TEF1p 5' fragment Saccharomyces cerevisiae Ampicillin PMID:24604451 Created by 4-part ligation with XhoI/EagI cut pBluescript II SK (-). Inserts were XhoI/XbaI TEF1p, XbaI/BamHI URA3, and BamHI/EagI TEF1p. Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin From SK1 background. -460 to -128 relative to TEF1 ORF 2026-08-15 01:15:48 0
pJH124
 
Resource Report
Resource Website 		RRID:Addgene_48259 URA3 3' fragment Saccharomyces cerevisiae Ampicillin PMID:24604451 pJH124 was created by cloning an XbaI/XhoI Ag TEF1 promoter fragment into the same sites of vector IpO. The cloned insert was confirmed by DNA sequencing. Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin URA3 ORF from +216 to 80 bp downstream of the stop codon 2026-08-15 01:15:49 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Join Dr. Chen Li for a Knowledge Portal Network Webinar on the dkNET Computational Core on August 6

Join NIH ODSS Data Sharing and Reuse Seminar "PanKbase: An Open, FAIR Knowledge Base of the Human Pancreas to Accelerate Diabetes Research"

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch