Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: nsp12-His6-3xFlag/nsp7/nsp8
Vector Backbone Description: Vector Backbone:pBIG2abc (biGBac); Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:34198323
Comments: Baculovirus generation using Tn7 transposition (Bac-to-Bac).
Proper citation: RRID:Addgene_169185 Copy
Species: Mus musculus
Genetic Insert: Foxo1-WT-DBD
Vector Backbone Description: Backbone Size:5600; Vector Backbone:pDNR-CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17717603
Comments: This plasmid also contains a E226G mutation--the author has determined that this mutation does not affect the plasmid detrimentally. It also has K219R and L619P polymorphisms.
Proper citation: RRID:Addgene_17555 Copy
Genetic Insert: pRARE2 + pBADmod1-linker2-gamS plasmid
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint.
Primers for genomic verification:
Foward - tattttccagtcgtgaaagc
Reverse - ttgctgatttcttccatcag
Primers for GamS plasmid verification:
Forward - aattatgacaacttgacggctacatcattc
Reverse - cgttcaccgacaaacaaca
Proper citation: RRID:Addgene_176584 Copy
Genetic Insert: pRARE2 + pBADmod1-linker2-gamS plasmid
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint.
Primers for recBCD deletion verification:
Foward - ttgatttactgcccgagagc
Reverse - gtcaaccgaatgcagacatc
Primers for GamS plasmid verification:
Forward - aattatgacaacttgacggctacatcattc
Reverse - cgttcaccgacaaacaaca
Proper citation: RRID:Addgene_176586 Copy
Vector Backbone Description: Backbone Marker:Andrew Fire; Vector Backbone:pPD158.87; Vector Types:Worm Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:34791215
Comments: Please visit https://doi.org/10.1101/2020.11.25.398784 for bioRxiv preprint.
Proper citation: RRID:Addgene_169692 Copy
Vector Backbone Description: Backbone Size:10394; Vector Backbone:pDEST-AD-CYH2; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35137167
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.07.27.453987v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_177795 Copy
Vector Backbone Description: Backbone Size:10164; Vector Backbone:pDEST-DB; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35137167
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.07.27.453987v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_177798 Copy
Vector Backbone Description: Backbone Size:10388; Vector Backbone:pDEST-AD-CYH2; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35137167
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.07.27.453987v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_177797 Copy
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35087108
Comments: This plasmid was designed to tag transcripts of insert at the 3' with an 12X MS2 stem loop tag. Insertion of the transcript of interst is performed by BsaI cloning.
5' BsaI generates ACAG overhang (BsaI recognition site 2659-2664)
3' BsaI generates CCCG overhang (BsaI recognition site 4086-4091)
These BsaI sites are lost upon insertion of the transcript of interest.
Proper citation: RRID:Addgene_177809 Copy
Vector Backbone Description: Backbone Marker:NA, NA, Invitrogen; Vector Backbone:pGP704, pBAD33, pDONR201; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:34801582
Comments: The plasmids from this article are also used with plasmid pXint129 (www.addgene.org/178208).
Proper citation: RRID:Addgene_178083 Copy
Genetic Insert: mTn7::Gateway cassette
Vector Backbone Description: Backbone Size:14263; Vector Backbone:pGRG37; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:16646962
Comments: Grow at 32'C. Contains Gateway cassette with ccdB gene. See author's protocol for more information.
This plasmid is designed to insert DNA into the chromosome of Enterobacteria in a manner that doesn't require a drug resistance marker. This plasmid uses the site-specific recombination machinery of the bacterial transposon Tn7. The backbone of the plasmid is the easily curable temperature sensitive mutant of pSC101.
Proper citation: RRID:Addgene_16667 Copy
Vector Backbone Description: Backbone Size:9796; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:19657394
Comments: Please note that Addgene's quality control sequence shows several gaps with depositor's reference sequence. These gaps are in vector region only and should not affect function.
Proper citation: RRID:Addgene_17392 Copy
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:8832; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:19657394
Proper citation: RRID:Addgene_17386 Copy
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:9150; Vector Backbone:pQCXIN; Vector Types:Retroviral, RNAi, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:19657394
Proper citation: RRID:Addgene_17399 Copy
Vector Backbone Description: Backbone Size:10140; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:19657394
Comments: Please note that there are several sequence discrepancies between Addgene's sequence and depositor's sequence. These mismatches are in backbone regions and should not affect function.
Proper citation: RRID:Addgene_17431 Copy
Vector Backbone Description: Backbone Size:8410; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:19657394
Proper citation: RRID:Addgene_17432 Copy
Vector Backbone Description: Backbone Size:9617; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:19657394
Proper citation: RRID:Addgene_17452 Copy
Vector Backbone Description: Backbone Size:10319; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:19657394
Comments: Please note that there are several mismatches between depositor's sequence and Addgene's quality control sequence. These mismatches are in the backbone regions only and do not affect any of the features.
Proper citation: RRID:Addgene_17454 Copy
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:8931; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral, RNAi, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:19657394
Proper citation: RRID:Addgene_17474 Copy
Vector Backbone Description: Vector Backbone:PB-TAG-ERN; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:33080218
Proper citation: RRID:Addgene_164519 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
