Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: GCN4-based single uORF-containing 5'-UTR
Vector Backbone Description: Backbone Size:6614; Vector Backbone:pCENBEVY-U; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24357599
Proper citation: RRID:Addgene_38220 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: 5' 1770 bp from STU2 ORF
Vector Backbone Description: Backbone Marker:GE healthcare; Backbone Size:4984; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22993214
Proper citation: RRID:Addgene_38314 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: 5' 918 bp from STU2 ORF
Vector Backbone Description: Backbone Marker:GE healthcare; Backbone Size:4984; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22993214
Proper citation: RRID:Addgene_38315 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: PPX1
Vector Backbone Description: Backbone Marker:K. Melcher; Vector Backbone:pKM263; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16184370
Proper citation: RRID:Addgene_38327 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Elongation factor 1 alpha-like protein
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_39337 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Elongation factor 1 alpha-like protein
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_39336 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Elongation factor 1 alpha-like protein
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_39338 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Lifeact
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23870127
Proper citation: RRID:Addgene_46357 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: sgRNA targeting endogenous TRE elements of pTET07 promoter
Vector Backbone Description: Backbone Size:5083; Vector Backbone:AH057; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23849981
Comments: gRNA target sequence TATCAGTGATAGAGAAAAGT
Proper citation: RRID:Addgene_46923 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Codon-optimized sequences for MEV pathway expression in E. coli to produce limonene
Vector Backbone Description: Backbone Size:3500; Vector Backbone:pBbA5a; Vector Types:Bacterial Expression, Synthetic Biology, BglBrick; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23727191
Comments: The R364S mutation in the MK is not known to alter the function. The plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_47049 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: mitochondrial targeting signal
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pAcGFP1-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21885730
Proper citation: RRID:Addgene_49151 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: autophagy-related 8
Vector Backbone Description: Backbone Size:4898; Vector Backbone:pRS416; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11739783
Proper citation: RRID:Addgene_49425 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: autophagy-related 8
Vector Backbone Description: Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12589048
Proper citation: RRID:Addgene_49424 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: autophagy-related 8
Vector Backbone Description: Backbone Size:4898; Vector Backbone:pRS416; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22977244
Proper citation: RRID:Addgene_49423 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Flp(H305L)
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9818722
Comments: This plasmid expresses a Flp ‘step-arrest’ mutant, Flp H305L, which carries out the first step of recombination, DNA cleavage, but fails to accomplish subsequent strand exchange and religation (Parsons et al.,1988).
Proper citation: RRID:Addgene_49459 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: MepTrac-H194E
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pDR GW; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23840931
Proper citation: RRID:Addgene_47764 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: meptrac
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pDR GW; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23840931
Proper citation: RRID:Addgene_47768 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: URA3 3' fragment
Vector Backbone Description: Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24604451
Proper citation: RRID:Addgene_48233 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TEF1p 5' fragment
Vector Backbone Description: Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24604451
Comments: Created by 4-part ligation with XhoI/EagI cut pBluescript II SK (-). Inserts were XhoI/XbaI TEF1p, XbaI/BamHI URA3, and BamHI/EagI TEF1p.
Proper citation: RRID:Addgene_48262 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: URA3 3' fragment
Vector Backbone Description: Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24604451
Comments: pJH124 was created by cloning an XbaI/XhoI Ag TEF1 promoter fragment into the same sites of vector IpO. The cloned insert was confirmed by DNA sequencing.
Proper citation: RRID:Addgene_48259 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
