Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Streptococcus pyogenes
Genetic Insert: S. pyogenes Cas9
Vector Backbone Description: Vector Backbone:2-micron/pUC; Vector Types:Yeast Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Hygromycin
Defining Citation: PMID:35708612
Comments: Part of the Markerless Yeast Localization and Overexpression (MyLO) CRISPR-Cas9 Toolkit. Vector cloned by homologous recombination in yeast following BglI/II digestion
Proper citation: RRID:Addgene_179079 Copy
Vector Backbone Description: Backbone Marker:Wilmanns lab; Backbone Size:6902; Vector Backbone:pMyNT; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:33006405
Proper citation: RRID:Addgene_84690 Copy
Species: n/a
Genetic Insert: MG1655.ΔTAG.ΔTGA.ΔprfA.mprfB3.A37G-tRNA-Trp
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:Hygromycin
Defining Citation: PMID:39910296
Proper citation: RRID:Addgene_234622 Copy
Species: Homo sapiens
Genetic Insert: Human collagen type IV alpha 4 chain (COL4A4)
Vector Backbone Description: Backbone Marker:Fujifilm/Wako; Vector Backbone:pEBMulti-Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:29526710
Proper citation: RRID:Addgene_229771 Copy
Vector Backbone Description: Backbone Size:2996; Vector Backbone:pUMN105; Vector Types:; Bacterial Resistance:Hygromycin
Defining Citation: PMID:41648453
Comments: Please visit https://doi.org/10.64898/2026.01.22.701086 for bioRxiv preprint.
Proper citation: RRID:Addgene_233024 Copy
Species: Plasmodiophora brassicae
Genetic Insert: PbGH3
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Backbone Size:10141; Vector Backbone:pMDC32; Vector Types:Plant Expression; Bacterial Resistance:Hygromycin
Proper citation: RRID:Addgene_232335 Copy
Species: Mycobacterium tuberculosis
Genetic Insert: PPE18-ALFA
Vector Backbone Description: Backbone Marker:Bryson Lab; Backbone Size:6512; Vector Backbone:pBB115; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Proper citation: RRID:Addgene_231247 Copy
Species: Mycobacterium tuberculosis
Genetic Insert: PPE18-HA
Vector Backbone Description: Backbone Size:6512; Vector Backbone:pBB115; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Proper citation: RRID:Addgene_231246 Copy
Vector Backbone Description: Backbone Size:9915; Vector Backbone:pBAC2015, pGM1190, and pUC19; Vector Types:; Bacterial Resistance:Hygromycin
Defining Citation: PMID:39666857
Proper citation: RRID:Addgene_227580 Copy
Species: Escherichia coli
Genetic Insert: Deficient in the P2 bacteriophage packaging cos site; rhamnose-inducible P4 delta (δ) and epsilon (ε) genes
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Hygromycin
Defining Citation: PMID:33317264
Comments: P2 bacteriophage lysogen derived from E. coli EMG C-5545 strain.
We designed a pair of primers to check the presence of P2 lysogen in this strain:
- P2 gpH C-ter gpG Fw: 5’ GCAGAGCACGAACAGTCACG 3’
- P2 gpH C-ter gpG Rv: 5’ TTATTGCGGCATTTCCGGCC 3’
These primers amplify the C-terminal region of the P2 gpH gene (tail fiber) and the complete gpG gene (tail fiber chaperone) (PCR fragment size: 2070 bp).
Proper citation: RRID:Addgene_209018 Copy
Species: Panicum virgatum
Genetic Insert: Pv4CL1
Vector Backbone Description: Backbone Size:4111; Vector Backbone:MoClo adapted pGAPZ-vector with hygromycin resistance; Vector Types:Yeast Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:38457503
Proper citation: RRID:Addgene_219768 Copy
Species: Derived from Aequorea victoria.
Genetic Insert: sfGFP
Vector Backbone Description: Vector Backbone:p15A and pWH1266; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:39302127
Comments: Shuttle vector that replicates in A. baumannii and E. coli; replicates in common cloning strains such as DH10B.
Proper citation: RRID:Addgene_222353 Copy
Vector Backbone Description: Vector Backbone:R6Kγ; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:39302127
Comments: Tn7 expression vector.
Proper citation: RRID:Addgene_222357 Copy
Vector Backbone Description: Backbone Marker:Ghader Bashiri; Backbone Size:4920; Vector Backbone:pYUB28b Addgene #37277; Vector Types:Bacterial Expression, mycobacteria shuttle vector; Bacterial Resistance:Hygromycin
Defining Citation: PMID:21209917
Comments: Plasmid contains 2 His tags within the multiple cloning site. Please see plasmid map from depositing laboratory above for details.
This plasmid is identical to pYUB28b Plasmid #37277, except that a single change was introduced to the MCS (NcoI in the original plasmid is replaced by SphI in this version of the plasmid).
Proper citation: RRID:Addgene_89179 Copy
Genetic Insert: none
Vector Backbone Description: Backbone Marker:Ghader Bashiri; Backbone Size:6040; Vector Backbone:pYUB28b Addgene #37277; Vector Types:Bacterial Expression, mycobacteria shuttle vector; Bacterial Resistance:Hygromycin
Defining Citation: PMID:21209917
Comments: Plasmid contains 2 His tags within the multiple cloning site. Please see plasmid map from depositing laboratory above for details.
Note that the MBP tag in this plasmid is a surface entropy reduced version of the tag in order to help crytallisation down the line, and therefore has 6 alanine substitutions compared to the standard MBP sequence.
Proper citation: RRID:Addgene_89178 Copy
Species: A .niger
Genetic Insert: gRNA (pyrg1)
Vector Backbone Description: Backbone Size:5997; Vector Backbone:BB3_AMA_2.8_pUC-ORI_L_AC_hph; Vector Types:Bacterial Expression, A. niger; Bacterial Resistance:Hygromycin
Defining Citation: PMID:28533066
Proper citation: RRID:Addgene_90276 Copy
Vector Backbone Description: Backbone Size:3287; Vector Backbone:BB3; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:29221460
Proper citation: RRID:Addgene_98545 Copy
Vector Backbone Description: Backbone Size:3287; Vector Backbone:BB3; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:29221460
Proper citation: RRID:Addgene_98544 Copy
Vector Backbone Description: Backbone Size:3287; Vector Backbone:BB3; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:29221460
Proper citation: RRID:Addgene_98547 Copy
Genetic Insert: hyg
Vector Backbone Description: Backbone Marker:N/A; Backbone Size:6300; Vector Backbone:pACBSR, which is based on pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:24398052
Proper citation: RRID:Addgene_87830 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.