Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: ProB-RBS(B0032)-Gemini (E0051)
Vector Backbone Description: Backbone Marker:http://parts.igem.org/Part:pSB3C5; Backbone Size:2738; Vector Backbone:pSB3C5; Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:20843779
Proper citation: RRID:Addgene_107243 Copy
Species: Synthetic
Genetic Insert: PBAD-EGFP-151TGA
Vector Backbone Description: Vector Backbone:de novo assembled; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29449507
Comments: pUC
Proper citation: RRID:Addgene_107886 Copy
Species: Synthetic
Genetic Insert: GFP
Vector Backbone Description: Vector Backbone:p15aC; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:30944849
Proper citation: RRID:Addgene_107862 Copy
Species: Synthetic
Genetic Insert: T7RNAP (modified)
Vector Backbone Description: Vector Backbone:pBAD33; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29472537
Comments: Please visit https://www.biorxiv.org/content/early/2017/10/17/204925 for bioRxiv preprint.
Proper citation: RRID:Addgene_107957 Copy
Species: Synthetic
Genetic Insert: T7RNAP (modified)
Vector Backbone Description: Vector Backbone:pBAD33; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29472537
Comments: Please visit https://www.biorxiv.org/content/early/2017/10/17/204925 for bioRxiv preprint.
Proper citation: RRID:Addgene_107955 Copy
Species: Vibrio fischeri
Genetic Insert: luxI
Vector Backbone Description: Vector Backbone:pSB1C3; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29472537
Comments: Please visit https://www.biorxiv.org/content/early/2017/10/17/204925 for bioRxiv preprint.
Proper citation: RRID:Addgene_107965 Copy
Species: Firefly
Genetic Insert: FF3
Vector Backbone Description: Backbone Size:8595; Vector Backbone:pPRIME-CMV-Neo; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:16141338
Comments: CMV promoter transcribes Neo and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site.
Please note that the full plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC)
Proper citation: RRID:Addgene_11665 Copy
Species: Firefly
Genetic Insert: FF3
Vector Backbone Description: Backbone Size:8226; Vector Backbone:pPRIME-TET-GFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:16141338
Comments: TET promoter (minimal CMV promoter containing seven upstream Tet-operator sites) transcribes GFP and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site.
Please note that the full plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC)
Proper citation: RRID:Addgene_11662 Copy
Species: Lactobacillus plantarum WCSF1
Genetic Insert: PorfX-Lp_0640-42, sapK-sappR
Vector Backbone Description: Vector Backbone:pSIP411, pNZ5319; Vector Types:other; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:30927506
Proper citation: RRID:Addgene_117261 Copy
Species: Synthetic
Genetic Insert: FnCas12a gRNA targeting TLR 2.0
Vector Backbone Description: Vector Backbone:pBluescript SK (+); Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:36070530
Comments: Please visit https://www.biorxiv.org/content/10.1101/864199v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_117412 Copy
Species: Rhodopseudomonas palustris CGA009
Genetic Insert: ppsR2
Vector Backbone Description: Vector Backbone:pProTet.E333; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29091422
Proper citation: RRID:Addgene_101068 Copy
Genetic Insert: CCAT-[MTS from S. cerevisiae Pyruvate dehydrogenase E1 component subunit alpha (YER178W)]-AATG
Vector Backbone Description: Vector Backbone:pUPD2; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29132331
Proper citation: RRID:Addgene_101694 Copy
Genetic Insert: CCAT-[MTS from S. cerevisiae ATP synthase subunit alpha (YBL099W)]-AATG
Vector Backbone Description: Vector Backbone:pUPD2; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29132331
Proper citation: RRID:Addgene_101696 Copy
Species: S. pyogenes
Genetic Insert: Cas9
Vector Backbone Description: Vector Backbone:pCas9-CR4; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:28915012
Proper citation: RRID:Addgene_102285 Copy
Genetic Insert: J23106:B0034:sfGFP:rrnBT1-T7TE
Vector Backbone Description: Backbone Marker:BioBricks Foundation; Backbone Size:2039; Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29293531
Proper citation: RRID:Addgene_102705 Copy
Genetic Insert: J23106:B0034:sfGFP:rrnBT1-T7TE
Vector Backbone Description: Backbone Marker:BioBricks Foundation; Backbone Size:2039; Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29293531
Proper citation: RRID:Addgene_102706 Copy
Genetic Insert: J23106:B0034:sfGFP:rrnBT1-T7TE
Vector Backbone Description: Backbone Marker:BioBricks Foundation; Backbone Size:2039; Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29293531
Proper citation: RRID:Addgene_102707 Copy
Species: Other
Genetic Insert: Green Fluorescent Protein
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pACYC; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29120463
Proper citation: RRID:Addgene_102791 Copy
Species: Other
Genetic Insert: Green Fluorescent Protein
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pACYC; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29120463
Proper citation: RRID:Addgene_102792 Copy
Genetic Insert: J23106:B0034:amilCP:rrnBT1-T7TE
Vector Backbone Description: Backbone Marker:BioBricks Foundation; Backbone Size:2039; Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29293531
Proper citation: RRID:Addgene_102680 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
