Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: tetR-P2A-eGFP-miR(FF4) target-miR(FF4)
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:8594; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34226556
Comments: Note that although the plasmid encodes a hygromycin resistance gene, it is not expressed from the plasmid. It is only expressed after Flp recombinase-mediated chromosomal integration of the plasmid.
Proper citation: RRID:Addgene_169734 Copy
Species: Synthetic
Genetic Insert: sgRNA towards glpR in Pseudomonas putida
Vector Backbone Description: Vector Backbone:pBBR1k-GFP; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34175462
Proper citation: RRID:Addgene_169873 Copy
Species: Synthetic
Genetic Insert: sgRNA targeting ACO1
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:11590; Vector Backbone:pLENTICRISPR V2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34039609
Comments: Target: CCACTACCCCAACCTGGCGG
Proper citation: RRID:Addgene_169892 Copy
Species: Synthetic
Genetic Insert: sgRNA targeting IREB2
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:11590; Vector Backbone:pLENTICRISPR V2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34039609
Comments: Target: AATGCACCAAATCCTGGAGG
Proper citation: RRID:Addgene_169894 Copy
Species: Synthetic
Genetic Insert: OxLight1
Vector Backbone Description: Backbone Marker:Viral Vector Facility - University of Zurich; Backbone Size:4438; Vector Backbone:pAAV.hSynapsin1; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35145320
Proper citation: RRID:Addgene_169792 Copy
Species: Synthetic
Genetic Insert: tetR-P2A-eGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6113; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34226556
Comments: Note that although the plasmid encodes a hygromycin resistance gene, it is not expressed from the plasmid. It is only expressed after Flp recombinase-mediated chromosomal integration of the plasmid.
Proper citation: RRID:Addgene_169747 Copy
Species: Synthetic
Genetic Insert: RRRAA
Vector Backbone Description: Vector Backbone:pHG165c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34369028
Proper citation: RRID:Addgene_170112 Copy
Species: Synthetic
Genetic Insert: UUUUA
Vector Backbone Description: Vector Backbone:pHG165c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34369028
Proper citation: RRID:Addgene_170107 Copy
Species: Synthetic
Genetic Insert: MelR
Vector Backbone Description: Vector Backbone:pHG165c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34369028
Proper citation: RRID:Addgene_170108 Copy
Species: Synthetic
Genetic Insert: bpNLS-nSpCas9(H840A)-MMLVRT-bpNLS-6xHis
Vector Backbone Description: Backbone Size:5238; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33927418
Comments: This is a bacterial codon-optimized SpCas9 (H840A) sequence within pET-28b backbone (Addgene #73018) fused to bipartite NLS, a 33-amino acid linker and the engineered M-MLV RT from the parental pCMV-PE2 plasmid (Addgene #132775). To this construct, a short GS linker and a 6xHis-tag are added to C terminus.
Proper citation: RRID:Addgene_170103 Copy
Species: Synthetic
Genetic Insert: deGFP
Vector Backbone Description: Backbone Size:2400; Vector Backbone:pBEST; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34985758
Proper citation: RRID:Addgene_170100 Copy
Species: Synthetic
Genetic Insert: deGFP
Vector Backbone Description: Backbone Size:2400; Vector Backbone:pBEST; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34985758
Proper citation: RRID:Addgene_170099 Copy
Species: Synthetic
Genetic Insert: deGFP
Vector Backbone Description: Backbone Size:2400; Vector Backbone:pBEST; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34985758
Proper citation: RRID:Addgene_170097 Copy
Species: Synthetic
Genetic Insert: deGFP
Vector Backbone Description: Backbone Size:2400; Vector Backbone:pBEST; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34985758
Proper citation: RRID:Addgene_170096 Copy
Species: Synthetic
Genetic Insert: iLight
Vector Backbone Description: Backbone Marker:Y. Yang lab (East China University of Science and Technology, China), https://pubmed.ncbi.nlm.nih.gov/27311594/; Backbone Size:5347; Vector Backbone:pLEVI(408)-ColE; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:34162879
Proper citation: RRID:Addgene_170268 Copy
Species: Synthetic
Genetic Insert: momeric Cherry
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7002; Vector Backbone:Modified pGBKT7; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_170264 Copy
Species: Synthetic
Genetic Insert: momeric Grape 3
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7002; Vector Backbone:Modified pGBKT7; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_170265 Copy
Species: Synthetic
Genetic Insert: A gRNA targeting the mouse Ptgs1 gene.
Vector Backbone Description: Backbone Marker:https://www.addgene.org/52961/; Vector Backbone:LentiCRISPRv2puro; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34035084
Proper citation: RRID:Addgene_170299 Copy
Species: Synthetic
Genetic Insert: enhanced green fluorescent protein
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7002; Vector Backbone:Modified pGBKT7; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_170210 Copy
Species: Synthetic
Genetic Insert: T7A1, O1, O-, Lambda t1 in lacZ fragment
Vector Backbone Description: Vector Backbone:pBR322; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Tetracycline
Defining Citation: PMID:35188572
Comments: LacI operators separated by 400 base pairs.
Proper citation: RRID:Addgene_170476 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.