Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Tcf-4
Vector Backbone Description: Backbone Size:4133; Vector Backbone:pCS105; Vector Types:Mammalian Expression, Xenopus, Avian, and Zebrafish expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9880534
Comments: Positive clone encoding mTcf4 obtained from screening a mouse embryonic gut cDNA library with degenerate oligos complementary to the highly conserved HMG box of Tcf/LEF proteins.
Proper citation: RRID:Addgene_11031 Copy
Species: Rattus norvegicus
Genetic Insert: IRS-1
Vector Backbone Description: Backbone Size:2958; Vector Backbone:pBluescript SK+; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: cDNA encoded from 659-4371 (see author's map).
Proper citation: RRID:Addgene_11027 Copy
Species: Mus musculus
Genetic Insert: IRS-1
Vector Backbone Description: Backbone Size:2958; Vector Backbone:pBluescript SK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: No stop codon.
Proper citation: RRID:Addgene_11026 Copy
Species: Homo sapiens
Genetic Insert: IRS-1
Vector Backbone Description: Backbone Marker:available at Addgene; Backbone Size:5169; Vector Backbone:pBABE puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9032279
Proper citation: RRID:Addgene_11025 Copy
Species: Homo sapiens
Genetic Insert: KGA glutaminase
Vector Backbone Description: Backbone Marker:#110344; Backbone Size:7423; Vector Backbone:pQC MCS IRES G418; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Comments: KGA.wt obtained with V5-6xHis from pcDNA3.1D V5-His-TOPO-KGA.wt (Addgene #110332)
pQC-based γ-Retroviral transfer vector for KGA.wt-V5 expression. IRES-driven Puromycin selection.
Weinberg Lab recommends using pUMVC (Addgene #8449) and VSV-G (#8454) for packaging.
Proper citation: RRID:Addgene_110390 Copy
Species: Homo sapiens
Genetic Insert: Yes
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_110497 Copy
Species: Homo sapiens
Genetic Insert: ELAVL1 (HuR)
Vector Backbone Description: Backbone Marker:#21915; Backbone Size:10633; Vector Backbone:Tet-pLKO-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Comments: See Addgene's pLKO family protocol http://www.addgene.org/plko on how to use the pLKO family vectors.
Plasmid grows more slowly than standard plasmids.
Proper citation: RRID:Addgene_110411 Copy
Species: Homo sapiens
Genetic Insert: SOX4
Vector Backbone Description: Backbone Marker:William Sellers; Vector Backbone:pcDNA3-Flag-FKHR; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16618720
Proper citation: RRID:Addgene_110360 Copy
Vector Backbone Description: Backbone Marker:#42230; Backbone Size:8506; Vector Backbone:pX330-U6-Chimeric_BB-CBh-hSpCas9; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: pX330 with puromycin resistance
For plasmid usage, please see the associated publication (Cong et al. Science. 2013, PMID: 23287718), as well as Ran et al. Nat Protoc. 2013, PMID: 24157548.
For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/
Proper citation: RRID:Addgene_110403 Copy
Species: Homo sapiens
Genetic Insert: GLS glutaminase
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6278; Vector Backbone:psiCHECK2; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_110401 Copy
Species: Synthetic
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:#21916; Backbone Size:10959; Vector Backbone:Tet-pLKO-neo; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31040181
Comments: See Addgene's pLKO family protocol http://www.addgene.org/plko on how to use the pLKO family vectors.
Plasmid grows more slowly than standard plasmids.
Proper citation: RRID:Addgene_110470 Copy
Species: Homo sapiens
Genetic Insert: Rab5C-S35N
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22674975
Proper citation: RRID:Addgene_110504 Copy
Species: Synthetic
Genetic Insert: GFP
Vector Backbone Description: Vector Backbone:RSF1010; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29608282
Proper citation: RRID:Addgene_110616 Copy
Species: Synthetic
Genetic Insert: GFP
Vector Backbone Description: Vector Backbone:RSF1010; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:29608282
Proper citation: RRID:Addgene_110618 Copy
Species: Mus musculus
Genetic Insert: Talin 1
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_110565 Copy
Species: Synthetic
Genetic Insert: GFP
Vector Backbone Description: Vector Backbone:RSF1010; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29608282
Proper citation: RRID:Addgene_110603 Copy
Species: Homo sapiens
Genetic Insert: Paf1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15632063
Comments: Author has deposited insert sequence. Click on "sequence" to view. Cloned using the following primers 5' CGGGATCCATGGCGCCCACCATCCAG 3' and 5' CCGCTCGAGTCAGTCACTGTCACTATCAGCTTCACTG 3'
Proper citation: RRID:Addgene_11059 Copy
Species: Mus musculus
Genetic Insert: HDAC1
Vector Backbone Description: Backbone Size:0; Vector Backbone:pK7; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15060137
Comments: Addgene sequencing data finds T189A and D332G substitutions. These are not known to affect function.
Proper citation: RRID:Addgene_11055 Copy
Species: Mus musculus
Genetic Insert: HDAC1
Vector Backbone Description: Backbone Size:0; Vector Backbone:pK7; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15060137
Proper citation: RRID:Addgene_11054 Copy
Species: Mus musculus
Genetic Insert: HDAC1
Vector Backbone Description: Backbone Size:0; Vector Backbone:pCIG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15060137
Comments: pCIG drives simultaneous expression of GFP and inserted genes by virtue of an internal ribosome entry site.
Proper citation: RRID:Addgene_11053 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.