Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Nr5a1 shRNA
Vector Backbone Description: Backbone Marker:Genscript; Backbone Size:6478; Vector Backbone:pRNAT-CMV3.1/Neo; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18388192
Comments: shRNA #3 sequence: GATCCTCAATGAGAAGGTTGTTGCGGTTGATATCCGCCGCAACAACCTTCTCATTGACGC
Proper citation: RRID:Addgene_28188 Copy
Species: Homo sapiens
Genetic Insert: CYP11A1:HPC09N-C05:C214491
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:6980; Vector Backbone:pCW-LIC (Addgene plasmid 26098); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: PDB: 3N9Y. http://www.thesgc.org/structures/3N9Y/
Human CYP11A1 fused with a portion of its cognate redox partner, ferredoxin. The CYP11A1 insert in this plasmid does not contain amino acids a1-40 of GenBank reference sequence NP_000772.2.
Proper citation: RRID:Addgene_28119 Copy
Species: Plasmodium falciparum
Genetic Insert: PF07_0029:MAC03H-B04:C212662
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7737; Vector Backbone:pET15-MHL (Addgene plasmid 26092); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: PDB: 3N72. http://www.thesgc.org/structures/3N72/
Proper citation: RRID:Addgene_28116 Copy
Species: Plasmodium berghei
Genetic Insert: PBG-PF11_0147
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7737; Vector Backbone:pET15-MHL (Addgene plasmid 26092); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: PDB: 3N9X. http://www.thesgc.org/structures/3N9X/
Proper citation: RRID:Addgene_28117 Copy
Species: Homo sapiens
Genetic Insert: SUV39H1
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB 3MTS: http://www.thesgc.org/structures/3MTS/
Proper citation: RRID:Addgene_28113 Copy
Species: Homo sapiens
Genetic Insert: Tar DNA binding protein
Vector Backbone Description: Backbone Marker:Clontech Laboratories, Inc; Backbone Size:4694; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21209826
Proper citation: RRID:Addgene_28198 Copy
Species: Plasmodium falciparum
Genetic Insert: PF11_0239:MAC03B-G02:C205882
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7737; Vector Backbone:pET15-MHL (Addgene plasmid 26092); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: PDB: 3MSE. http://www.thesgc.org/structures/3MSE/
Proper citation: RRID:Addgene_28111 Copy
Species: synthetic gene fragment
Genetic Insert: Tetrahymena TERT
Vector Backbone Description: Backbone Size:5700; Vector Backbone:pET21; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15731105
Proper citation: RRID:Addgene_28172 Copy
Species: Homo sapiens
Genetic Insert: U3-hTR-500
Vector Backbone Description: Backbone Size:2900; Vector Backbone:pBS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12769858
Comments: Note that BLAST results bring back one T->C nt change in the TERC, but this is the plasmid used in the associated article.
Proper citation: RRID:Addgene_28170 Copy
Species: synthetic gene fragment
Genetic Insert: Tetrahymena TERT
Vector Backbone Description: Backbone Size:5300; Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15731105
Proper citation: RRID:Addgene_28171 Copy
Species: Homo sapiens
Genetic Insert: eGFPhTERT
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pBABEhygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12198499
Proper citation: RRID:Addgene_28169 Copy
Species: Homo sapiens
Genetic Insert: Tar DNA binding protein
Vector Backbone Description: Backbone Marker:Clontech Laboratories, Inc; Backbone Size:4694; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21209826
Proper citation: RRID:Addgene_28202 Copy
Species: Plasmodium falciparum
Genetic Insert: RAB GDP dissociation inhibitor
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7737; Vector Backbone:pET15-MHL (Addgene plasmid 26092); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: PDB: 3P1W. http://www.thesgc.org/structures/3P1W/
Proper citation: RRID:Addgene_28167 Copy
Species: Homo sapiens
Genetic Insert: Tar DNA binding protein
Vector Backbone Description: Backbone Marker:Clontech Laboratories, Inc; Backbone Size:4694; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21209826
Proper citation: RRID:Addgene_28200 Copy
Species: Homo sapiens
Genetic Insert: ARF1
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3O47. http://www.thesgc.org/structures/3O47/
Proper citation: RRID:Addgene_28168 Copy
Species: Homo sapiens
Genetic Insert: Tar DNA binding protein
Vector Backbone Description: Backbone Marker:Clontech Laboratories, Inc; Backbone Size:4694; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21209826
Proper citation: RRID:Addgene_28201 Copy
Species: Homo sapiens
Genetic Insert: EPHB3
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:0; Vector Backbone:pFHMSP-LIC-N (Addgene plasmid 26095); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: PDB: 3P1I. http://www.thesgc.org/structures/3P1I/
Proper citation: RRID:Addgene_28165 Copy
Species: Homo sapiens
Genetic Insert: GTPase IMAP family member 2
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3P1J. http://www.thesgc.org/structures/3P1J/
Proper citation: RRID:Addgene_28166 Copy
Species: Homo sapiens
Genetic Insert: UHRF1
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2L3R. http://www.thesgc.org/structures/2L3R/
Proper citation: RRID:Addgene_28163 Copy
Species: Mus musculus
Genetic Insert: Adcy4 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5000; Vector Backbone:pGL3-basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12239114
Comments: Contains a total of ~1812 bp of genomic DNA--i.e.,1459 bp upstream of the Adcy4 transcription start site and 353 bp downstream of the transcription start site. The downstream DNA includes exon I, intron I and the non-coding portion of exon II.
Proper citation: RRID:Addgene_28184 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
