Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: trLAT
Vector Backbone Description: Backbone Marker:Ilya Levental lab; Vector Backbone:trLAT-mRFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:36997644
Proper citation: RRID:Addgene_203745 Copy
Species: Geobacillus stearothermophilus
Genetic Insert: PheB
Vector Backbone Description: Backbone Size:4719; Vector Backbone:pG1AK; Vector Types:Bacterial Expression, Synthetic Biology, Shuttle Vector; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27332993
Comments: Plasmid from the Geobacillus plasmid set - a modular shuttle vector toolkit for thermophile metabolic engineering
Proper citation: RRID:Addgene_71738 Copy
Genetic Insert: mCherry
Vector Backbone Description: Backbone Size:4719; Vector Backbone:pG1AK; Vector Types:Bacterial Expression, Synthetic Biology, Shuttle Vector; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27332993
Comments: Plasmid from the Geobacillus plasmid set - a modular shuttle vector toolkit for thermophile metabolic engineering
Proper citation: RRID:Addgene_71737 Copy
Species: Synthetic
Genetic Insert: Genomic cassette
Vector Backbone Description: Vector Backbone:SEVA; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:24847673
Proper citation: RRID:Addgene_58305 Copy
Species: Synthetic
Genetic Insert: Genomic cassette
Vector Backbone Description: Vector Backbone:SEVA; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:24847673
Proper citation: RRID:Addgene_58304 Copy
Species: Synthetic
Genetic Insert: Genomic cassette
Vector Backbone Description: Vector Backbone:SEVA; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:24847673
Proper citation: RRID:Addgene_58307 Copy
Species: Synthetic
Genetic Insert: TT-ISceI-kan
Vector Backbone Description: Backbone Marker:Copley Lab; Backbone Size:1887; Vector Backbone:pHA1887, an 1887 bp fragment extending from bp 690 to bp 2576 of pUC19 (Acc. No. M77789); Vector Types:template; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:25255806
Comments: iGEM parts BBa_B1002 and BBa_B1006 were used to build the double terminator element. The kanamycin resistance gene was taken from pACYC177. We developed GetX (https://sourceforge.net/projects/getx/), a stand-alone python script that allows the user to design mutation cassettes for scarless genome editing in bacteria using our previously described two-step recombination method. Please see the document linked under the Resource Information heading above for additional information on installing and using the script.
Proper citation: RRID:Addgene_59383 Copy
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC; Vector Types:Bacterial shuttle vector; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:8157596
Comments: Additional references:
Elhai J, Wolk CP (1988) A versatile class of positive selection vectors based on the nonviability of palindrome-containing plasmids that allows cloning into long polylinkers. Gene 68: 119-138
Kuritz T, Ernst A, Black TA, Wolk CP (1993) High-resolution mapping of genetic loci of Anabaena PCC 7120 required for photosynthesis and nitrogen fixation. Mol Microbiol 8: 101-110
Proper citation: RRID:Addgene_70283 Copy
Species: S. pyogenes
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Thermo-Fisher; Backbone Size:3900; Vector Backbone:PCR2-1 TOPO; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin and Kanamycin
Comments: The poly A tail included in the sequence is sufficient for purification of full length transcript using an oligo dT column. This decreases the amount of incomplete transcripts (and therefore decreases truncated Cas9 proteins).
Proper citation: RRID:Addgene_71310 Copy
Species: Other
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27780958
Comments: Addgene's sequencing results found K128R and Q193P mutations in mCherry. These mutations are not known to affect plasmid function.
Proper citation: RRID:Addgene_92092 Copy
Species: Other
Genetic Insert: 4xFlag
Vector Backbone Description: Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27780958
Proper citation: RRID:Addgene_92090 Copy
Species: Other
Genetic Insert: 6xHA
Vector Backbone Description: Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27780958
Proper citation: RRID:Addgene_92091 Copy
Species: Other
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27780958
Proper citation: RRID:Addgene_92089 Copy
Species: Other
Genetic Insert: 6xHA
Vector Backbone Description: Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27780958
Proper citation: RRID:Addgene_92087 Copy
Species: Other
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27780958
Comments: Addgene's sequencing results found K128R and Q193P mutations in mCherry. These mutations are not known to affect plasmid function.
Proper citation: RRID:Addgene_92088 Copy
Species: Synthetic
Genetic Insert: Actb HR donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28524166
Proper citation: RRID:Addgene_97317 Copy
Species: Synthetic
Genetic Insert: Actb HMEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28524166
Comments: gRNA sequence: agtccgcctagaagcacttg
Proper citation: RRID:Addgene_97318 Copy
Species: Synthetic
Genetic Insert: Dbh HMEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28524166
Comments: gRNA sequence: agaatagcttctcacaaggt
Proper citation: RRID:Addgene_97320 Copy
Vector Backbone Description: Backbone Size:4384; Vector Backbone:pBAM1; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:21342504
Proper citation: RRID:Addgene_60487 Copy
Genetic Insert: eGFP-Kana_I-SceI
Vector Backbone Description: Vector Backbone:pEGFP N1; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:16526409
Proper citation: RRID:Addgene_60961 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.