Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:ampicillin and kanamycin (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

1,969 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
trLATmEos3.2
 
Resource Report
Resource Website
RRID:Addgene_203745 trLAT Homo sapiens Ampicillin and Kanamycin PMID:36997644 Backbone Marker:Ilya Levental lab; Vector Backbone:trLAT-mRFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:27:20 0
pG1AK-PheB
 
Resource Report
Resource Website
RRID:Addgene_71738 PheB Geobacillus stearothermophilus Ampicillin and Kanamycin PMID:27332993 Plasmid from the Geobacillus plasmid set - a modular shuttle vector toolkit for thermophile metabolic engineering Backbone Size:4719; Vector Backbone:pG1AK; Vector Types:Bacterial Expression, Synthetic Biology, Shuttle Vector; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:19:13 0
pG1AK-mCherry
 
Resource Report
Resource Website
RRID:Addgene_71737 mCherry Ampicillin and Kanamycin PMID:27332993 Plasmid from the Geobacillus plasmid set - a modular shuttle vector toolkit for thermophile metabolic engineering Backbone Size:4719; Vector Backbone:pG1AK; Vector Types:Bacterial Expression, Synthetic Biology, Shuttle Vector; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:19:13 0
pSEVA12DKR-E
 
Resource Report
Resource Website
RRID:Addgene_58305 Genomic cassette Synthetic Ampicillin and Kanamycin PMID:24847673 Vector Backbone:SEVA; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:17:15 0
pSEVA12DKR-A
 
Resource Report
Resource Website
RRID:Addgene_58304 Genomic cassette Synthetic Ampicillin and Kanamycin PMID:24847673 Vector Backbone:SEVA; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:17:15 0
pSEVA12TEC-B
 
Resource Report
Resource Website
RRID:Addgene_58307 Genomic cassette Synthetic Ampicillin and Kanamycin PMID:24847673 Vector Backbone:SEVA; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:17:15 0
pT2SK
 
Resource Report
Resource Website
RRID:Addgene_59383 TT-ISceI-kan Synthetic Ampicillin and Kanamycin PMID:25255806 iGEM parts BBa_B1002 and BBa_B1006 were used to build the double terminator element. The kanamycin resistance gene was taken from pACYC177. We developed GetX (https://sourceforge.net/projects/getx/), a stand-alone python script that allows the user to design mutation cassettes for scarless genome editing in bacteria using our previously described two-step recombination method. Please see the document linked under the Resource Information heading above for additional information on installing and using the script. Backbone Marker:Copley Lab; Backbone Size:1887; Vector Backbone:pHA1887, an 1887 bp fragment extending from bp 690 to bp 2576 of pUC19 (Acc. No. M77789); Vector Types:template; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:17:23 0
pRL648
 
Resource Report
Resource Website
RRID:Addgene_70283 Ampicillin and Kanamycin PMID:8157596 Additional references: Elhai J, Wolk CP (1988) A versatile class of positive selection vectors based on the nonviability of palindrome-containing plasmids that allows cloning into long polylinkers. Gene 68: 119-138 Kuritz T, Ernst A, Black TA, Wolk CP (1993) High-resolution mapping of genetic loci of Anabaena PCC 7120 required for photosynthesis and nitrogen fixation. Mol Microbiol 8: 101-110 Backbone Size:2686; Vector Backbone:pUC; Vector Types:Bacterial shuttle vector; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:19:03 0
TC9pAB
 
Resource Report
Resource Website
RRID:Addgene_71310 Cas9 S. pyogenes Ampicillin and Kanamycin The poly A tail included in the sequence is sufficient for purification of full length transcript using an oligo dT column. This decreases the amount of incomplete transcripts (and therefore decreases truncated Cas9 proteins). Backbone Marker:Thermo-Fisher; Backbone Size:3900; Vector Backbone:PCR2-1 TOPO; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:19:10 0
YSBE 628 : pHYG_mCherry
 
Resource Report
Resource Website
RRID:Addgene_92092 mCherry Other Ampicillin and Kanamycin PMID:27780958 Addgene's sequencing results found K128R and Q193P mutations in mCherry. These mutations are not known to affect plasmid function. Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:22:27 0
YSBE 731 : pHYG_4xFLAG
 
Resource Report
Resource Website
RRID:Addgene_92090 4xFlag Other Ampicillin and Kanamycin PMID:27780958 Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:22:27 0
YSBE 610 : pHYG_6xHA
 
Resource Report
Resource Website
RRID:Addgene_92091 6xHA Other Ampicillin and Kanamycin PMID:27780958 Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:22:27 0
YSBE 608 : pHYG_GFP
 
Resource Report
Resource Website
RRID:Addgene_92089 GFP Other Ampicillin and Kanamycin PMID:27780958 Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:22:27 0
YSBE 559 : pNAT_6xHA
 
Resource Report
Resource Website
RRID:Addgene_92087 6xHA Other Ampicillin and Kanamycin PMID:27780958 Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:22:27 0
YSBE 596 : pNAT_mCherry
 
Resource Report
Resource Website
RRID:Addgene_92088 mCherry Other Ampicillin and Kanamycin PMID:27780958 Addgene's sequencing results found K128R and Q193P mutations in mCherry. These mutations are not known to affect plasmid function. Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:22:27 0
AAV_Actb HR donor
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_97317 Actb HR donor Synthetic Ampicillin and Kanamycin PMID:28524166 Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:22:34 2
AAV_Actb HMEJ donor
 
Resource Report
Resource Website
RRID:Addgene_97318 Actb HMEJ donor Synthetic Ampicillin and Kanamycin PMID:28524166 gRNA sequence: agtccgcctagaagcacttg Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:22:34 0
AAV_Dbh HMEJ donor
 
Resource Report
Resource Website
RRID:Addgene_97320 Dbh HMEJ donor Synthetic Ampicillin and Kanamycin PMID:28524166 gRNA sequence: agaatagcttctcacaaggt Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:22:34 0
pBAM1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_60487 Ampicillin and Kanamycin PMID:21342504 Backbone Size:4384; Vector Backbone:pBAM1; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:17:32 3
pEP-EGFPin
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_60961 eGFP-Kana_I-SceI Ampicillin and Kanamycin PMID:16526409 Vector Backbone:pEGFP N1; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:17:37 2

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.