Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
trLATmEos3.2 Resource Report Resource Website |
RRID:Addgene_203745 | trLAT | Homo sapiens | Ampicillin and Kanamycin | PMID:36997644 | Backbone Marker:Ilya Levental lab; Vector Backbone:trLAT-mRFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:27:20 | 0 | ||
|
pG1AK-PheB Resource Report Resource Website |
RRID:Addgene_71738 | PheB | Geobacillus stearothermophilus | Ampicillin and Kanamycin | PMID:27332993 | Plasmid from the Geobacillus plasmid set - a modular shuttle vector toolkit for thermophile metabolic engineering | Backbone Size:4719; Vector Backbone:pG1AK; Vector Types:Bacterial Expression, Synthetic Biology, Shuttle Vector; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:19:13 | 0 | |
|
pG1AK-mCherry Resource Report Resource Website |
RRID:Addgene_71737 | mCherry | Ampicillin and Kanamycin | PMID:27332993 | Plasmid from the Geobacillus plasmid set - a modular shuttle vector toolkit for thermophile metabolic engineering | Backbone Size:4719; Vector Backbone:pG1AK; Vector Types:Bacterial Expression, Synthetic Biology, Shuttle Vector; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:19:13 | 0 | ||
|
pSEVA12DKR-E Resource Report Resource Website |
RRID:Addgene_58305 | Genomic cassette | Synthetic | Ampicillin and Kanamycin | PMID:24847673 | Vector Backbone:SEVA; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:17:15 | 0 | ||
|
pSEVA12DKR-A Resource Report Resource Website |
RRID:Addgene_58304 | Genomic cassette | Synthetic | Ampicillin and Kanamycin | PMID:24847673 | Vector Backbone:SEVA; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:17:15 | 0 | ||
|
pSEVA12TEC-B Resource Report Resource Website |
RRID:Addgene_58307 | Genomic cassette | Synthetic | Ampicillin and Kanamycin | PMID:24847673 | Vector Backbone:SEVA; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:17:15 | 0 | ||
|
pT2SK Resource Report Resource Website |
RRID:Addgene_59383 | TT-ISceI-kan | Synthetic | Ampicillin and Kanamycin | PMID:25255806 | iGEM parts BBa_B1002 and BBa_B1006 were used to build the double terminator element. The kanamycin resistance gene was taken from pACYC177. We developed GetX (https://sourceforge.net/projects/getx/), a stand-alone python script that allows the user to design mutation cassettes for scarless genome editing in bacteria using our previously described two-step recombination method. Please see the document linked under the Resource Information heading above for additional information on installing and using the script. | Backbone Marker:Copley Lab; Backbone Size:1887; Vector Backbone:pHA1887, an 1887 bp fragment extending from bp 690 to bp 2576 of pUC19 (Acc. No. M77789); Vector Types:template; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:17:23 | 0 | |
|
pRL648 Resource Report Resource Website |
RRID:Addgene_70283 | Ampicillin and Kanamycin | PMID:8157596 | Additional references: Elhai J, Wolk CP (1988) A versatile class of positive selection vectors based on the nonviability of palindrome-containing plasmids that allows cloning into long polylinkers. Gene 68: 119-138 Kuritz T, Ernst A, Black TA, Wolk CP (1993) High-resolution mapping of genetic loci of Anabaena PCC 7120 required for photosynthesis and nitrogen fixation. Mol Microbiol 8: 101-110 | Backbone Size:2686; Vector Backbone:pUC; Vector Types:Bacterial shuttle vector; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:19:03 | 0 | |||
|
TC9pAB Resource Report Resource Website |
RRID:Addgene_71310 | Cas9 | S. pyogenes | Ampicillin and Kanamycin | The poly A tail included in the sequence is sufficient for purification of full length transcript using an oligo dT column. This decreases the amount of incomplete transcripts (and therefore decreases truncated Cas9 proteins). | Backbone Marker:Thermo-Fisher; Backbone Size:3900; Vector Backbone:PCR2-1 TOPO; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:19:10 | 0 | ||
|
YSBE 628 : pHYG_mCherry Resource Report Resource Website |
RRID:Addgene_92092 | mCherry | Other | Ampicillin and Kanamycin | PMID:27780958 | Addgene's sequencing results found K128R and Q193P mutations in mCherry. These mutations are not known to affect plasmid function. | Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:27 | 0 | |
|
YSBE 731 : pHYG_4xFLAG Resource Report Resource Website |
RRID:Addgene_92090 | 4xFlag | Other | Ampicillin and Kanamycin | PMID:27780958 | Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:27 | 0 | ||
|
YSBE 610 : pHYG_6xHA Resource Report Resource Website |
RRID:Addgene_92091 | 6xHA | Other | Ampicillin and Kanamycin | PMID:27780958 | Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:27 | 0 | ||
|
YSBE 608 : pHYG_GFP Resource Report Resource Website |
RRID:Addgene_92089 | GFP | Other | Ampicillin and Kanamycin | PMID:27780958 | Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:27 | 0 | ||
|
YSBE 559 : pNAT_6xHA Resource Report Resource Website |
RRID:Addgene_92087 | 6xHA | Other | Ampicillin and Kanamycin | PMID:27780958 | Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:27 | 0 | ||
|
YSBE 596 : pNAT_mCherry Resource Report Resource Website |
RRID:Addgene_92088 | mCherry | Other | Ampicillin and Kanamycin | PMID:27780958 | Addgene's sequencing results found K128R and Q193P mutations in mCherry. These mutations are not known to affect plasmid function. | Backbone Marker:Enzynomics, Korea; Vector Backbone:pTOP-V2; Vector Types: tagging proteins in Cryptococcus neoforman; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:27 | 0 | |
|
AAV_Actb HR donor Resource Report Resource Website 1+ mentions |
RRID:Addgene_97317 | Actb HR donor | Synthetic | Ampicillin and Kanamycin | PMID:28524166 | Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:34 | 2 | ||
|
AAV_Actb HMEJ donor Resource Report Resource Website |
RRID:Addgene_97318 | Actb HMEJ donor | Synthetic | Ampicillin and Kanamycin | PMID:28524166 | gRNA sequence: agtccgcctagaagcacttg | Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:34 | 0 | |
|
AAV_Dbh HMEJ donor Resource Report Resource Website |
RRID:Addgene_97320 | Dbh HMEJ donor | Synthetic | Ampicillin and Kanamycin | PMID:28524166 | gRNA sequence: agaatagcttctcacaaggt | Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:34 | 0 | |
|
pBAM1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_60487 | Ampicillin and Kanamycin | PMID:21342504 | Backbone Size:4384; Vector Backbone:pBAM1; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:17:32 | 3 | ||||
|
pEP-EGFPin Resource Report Resource Website 1+ mentions |
RRID:Addgene_60961 | eGFP-Kana_I-SceI | Ampicillin and Kanamycin | PMID:16526409 | Vector Backbone:pEGFP N1; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:17:37 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.