Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: hsa-miR-675-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.
Proper citation: RRID:Addgene_103721 Copy
Species: Soybean
Genetic Insert: APEX2
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:3267; Vector Backbone:pKD4; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:30275513
Proper citation: RRID:Addgene_112868 Copy
Species: Synthetic
Genetic Insert: CMV-OsTIR1-loxP-PURO-loxP
Vector Backbone Description: Vector Backbone:pBluescript; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31026591
Comments: This plasmid is a variant of Addgene plasmid 72834.
Proper citation: RRID:Addgene_121184 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR2.1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27088393
Proper citation: RRID:Addgene_126577 Copy
Species: Komagataella phaffii
Genetic Insert: acc1*
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9004; Vector Backbone:pPIC3.5K; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31077813
Proper citation: RRID:Addgene_126740 Copy
Species: Aspergillus terreus, Escherichia coli, Komagataella phaffii
Genetic Insert: slovA,cpr
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9004; Vector Backbone:pPIC3.5K; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31077813
Proper citation: RRID:Addgene_126745 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: adh2, acs1*, ald6
Vector Backbone Description: Backbone Marker:Liu Yiqi; Backbone Size:6469; Vector Backbone:pPIC 3.5K(DHis4); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31077813
Comments: Depositor confirms the following mutations A30S and S629N do not affect function.
Proper citation: RRID:Addgene_126739 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: adh2
Vector Backbone Description: Backbone Marker:Liu Yiqi; Backbone Size:6469; Vector Backbone:pPIC 3.5K(DHis4); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31077813
Proper citation: RRID:Addgene_126734 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: acs1*
Vector Backbone Description: Backbone Marker:Liu Yiqi; Backbone Size:6469; Vector Backbone:pPIC 3.5K(DHis4); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31077813
Comments: Dep. confirms the following mutations A30S, P113S, and S629N do not affect function.
Proper citation: RRID:Addgene_126736 Copy
Species: Aspergillus terreus, Aspergillus nidulans
Genetic Insert: atX,npgA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9004; Vector Backbone:pPIC3.5K; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31077813
Proper citation: RRID:Addgene_126725 Copy
Species: Homo sapiens
Genetic Insert: ZNF8
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Comments: Cloning source: K562
Proper citation: RRID:Addgene_136689 Copy
Species: Other
Genetic Insert: mCherry
Vector Backbone Description: Vector Backbone:PUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31909199
Comments: The Addgene NGS result is not a full plasmid sequence and does not completely confirm the A/T rich Plasmodium cynomolgi strain M centromere sequence. A NotI restriction digest should be used to verify the plasmid, as an intact plasmid will yield 2 bands that add up to the full plasmid size of approximately 16 kb.
Proper citation: RRID:Addgene_137169 Copy
Species: Synthetic
Genetic Insert: CRISPR/Cas9
Vector Backbone Description: Vector Backbone:pGreen3; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31558579
Proper citation: RRID:Addgene_134754 Copy
Species: Synthetic
Genetic Insert: CRISPR/Cas9
Vector Backbone Description: Vector Backbone:pGreen3; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31558579
Proper citation: RRID:Addgene_134757 Copy
Species: Pseudomonas putida
Genetic Insert: up- and downstream regions of upp
Vector Backbone Description: Vector Backbone:pJOE6186.1 ; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:21666018
Proper citation: RRID:Addgene_135078 Copy
Species: Synthetic
Genetic Insert: E2-Crimson cassette flanked with homology arms for recombination into the S. alvi wkB2 genome to replace clpA (SALWKB2_RS04465)
Vector Backbone Description: Backbone Size:1887; Vector Backbone:pYTK095; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:37786689
Comments: Please visit https://doi.org/10.1101/2023.09.19.558440 for bioRxiv preprint.
Proper citation: RRID:Addgene_209550 Copy
Species: Synthetic
Genetic Insert: PAGFP-FLAG-Kan
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Proper citation: RRID:Addgene_211834 Copy
Species: Synthetic
Genetic Insert: sfGFP-FLAG-Kan
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Proper citation: RRID:Addgene_211833 Copy
Species: Homo sapiens
Genetic Insert: 2xCHS4_hSYN1_INTRON_dTomato-WPRE-SV40-2xCHS4
Vector Backbone Description: Vector Backbone:AAVS1-SA-Puro; Vector Types:ZNF donor; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:36989136
Comments: For this purpose, a previously generated backbone containing 2xCHS4-EF1a-tdTomato-SV40-2xCHS4 was used (Bagley et al., 2017).
Please visit https://www.biorxiv.org/content/10.1101/2022.10.07.511280v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_196192 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:PCR4-TOPO; Vector Types:Mammalian Expression, Mouse Targeting, CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:39762235
Proper citation: RRID:Addgene_211941 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.