Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Rattus norvegicus
Genetic Insert: cacna1a
Vector Backbone Description: Backbone Marker:Genetics Institute Inc; Backbone Size:5163; Vector Backbone:pMT2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19903821
Proper citation: RRID:Addgene_206119 Copy
Species: Rattus norvegicus
Genetic Insert: cacna2d1
Vector Backbone Description: Backbone Marker:Genetics Institute Inc; Backbone Size:5163; Vector Backbone:pMT2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24889613
Proper citation: RRID:Addgene_206111 Copy
Species: Rattus norvegicus
Genetic Insert: cacna2d1
Vector Backbone Description: Backbone Marker:Genetics Institute Inc; Backbone Size:5163; Vector Backbone:pMT2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24889613
Proper citation: RRID:Addgene_206110 Copy
Species: Rattus norvegicus
Genetic Insert: cacna1b
Vector Backbone Description: Backbone Marker:PMID 11397804; Backbone Size:5446; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31577951
Proper citation: RRID:Addgene_206115 Copy
Species: Rattus norvegicus
Genetic Insert: 2',3'-cyclic nucleotide phosphodiesterase catalytic domain
Vector Backbone Description: Backbone Size:3641; Vector Backbone:pKT; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29555843
Proper citation: RRID:Addgene_211804 Copy
Species: Rattus norvegicus
Genetic Insert: Rattus rattus biliverdin reductase A flanked with an N-terminal plastid transit peptide and a C-terminal FLAG tag.
Vector Backbone Description: Vector Backbone:pGWB511; Vector Types:Bacterial Expression, Plant Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:37285441
Proper citation: RRID:Addgene_203480 Copy
Species: Rattus norvegicus
Genetic Insert: rat Apobec1 and human ADAR2 deaminase domain with engineered sites
Vector Backbone Description: Backbone Marker:Connie Cepko Lab; Backbone Size:6124; Vector Backbone:pCAGIG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37280234
Proper citation: RRID:Addgene_204818 Copy
Species: Rattus norvegicus
Genetic Insert: syt1
Vector Backbone Description: Vector Backbone:pET-28 a (+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38177243
Comments: Please visit https://doi.org/10.1101/2023.08.11.551903 for bioRxiv preprint.
Proper citation: RRID:Addgene_209006 Copy
Species: Rattus norvegicus
Genetic Insert: syt1
Vector Backbone Description: Vector Backbone:pET-28 a (+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38177243
Comments: Please visit https://doi.org/10.1101/2023.08.11.551903 for bioRxiv preprint.
Proper citation: RRID:Addgene_209012 Copy
Species: Rattus norvegicus
Genetic Insert: syt1
Vector Backbone Description: Vector Backbone:pET-28 a (+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38177243
Comments: Juxta K mutant neutralizing the juxtamembrane lysine residues. Please visit https://doi.org/10.1101/2023.08.11.551903 for bioRxiv preprint.
Proper citation: RRID:Addgene_209013 Copy
Species: Rattus norvegicus
Genetic Insert: syt1
Vector Backbone Description: Vector Backbone:FUGW (Addgene #14883); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38177243
Comments: Juxta K mutant neutralizing the juxtamembrane lysine residues. Please visit https://doi.org/10.1101/2023.08.11.551903 for bioRxiv preprint.
Proper citation: RRID:Addgene_209016 Copy
Species: Rattus norvegicus
Genetic Insert: Mlle domain of UBR5
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4984; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16554297
Proper citation: RRID:Addgene_209791 Copy
Species: Rattus norvegicus
Genetic Insert: GAP43-jRGECO1a P2A Syp-Halo
Vector Backbone Description: Backbone Size:8400; Vector Backbone:pFSW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34957569
Proper citation: RRID:Addgene_185565 Copy
Species: Rattus norvegicus
Genetic Insert: Synaptophysin
Vector Backbone Description: Vector Backbone:pEF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29754754
Proper citation: RRID:Addgene_188980 Copy
Species: Rattus norvegicus
Genetic Insert: myosin 1b isoform b
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4752; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10233157
Comments: The expression of the recombinant plasmid includes the addition of 18 amino acids (SGLRSRAQASNSDPRYPP) between GFP and Myo1b.
Proper citation: RRID:Addgene_187362 Copy
Species: Rattus norvegicus
Genetic Insert: myosin 1b isoform b
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4743; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29588377
Comments: The expression of the recombinant plasmid includes the addition of 18 amino acids (SGLRSRAQASNSDPRYPP) between Cherry and Myo1b.
Proper citation: RRID:Addgene_187366 Copy
Species: Rattus norvegicus
Genetic Insert: myosin 1b isoform b Tail domain
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4713; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26195670
Comments: PCR cloning at BglII-SalI DNA fragment was generated by PCR on rat Myo1b cDNA with 5' primer TTGGCCATCAAGACCTTACCTA and 3' primer CCTCACTTAAGGGACAGCGACTT
Proper citation: RRID:Addgene_187365 Copy
Species: Rattus norvegicus
Genetic Insert: myosin 1b isoform b IQTail domain
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4743; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10233157
Comments: The expression of the recombinant plasmid includes the addition of 18 amino acids (SGLRSRAQASNSDPRYPP) between GFP and Myo1b. Cloning by deletion of the fragment EcoRV-EcoRV from the recombinant plasmid encoding GFP-Myo1b.
Proper citation: RRID:Addgene_187363 Copy
Species: Rattus norvegicus
Genetic Insert: Syntaxin 3
Vector Backbone Description: Vector Backbone:pTEV5; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35322233
Proper citation: RRID:Addgene_186685 Copy
Species: Rattus norvegicus
Genetic Insert: mKeima, LC3
Vector Backbone Description: Vector Backbone:pMSCV PGK-neo; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37443159
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.02.22.481456v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_189006 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
