Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

742,877 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pGBW-m4133899
 
Resource Report
Resource Website
RRID:Addgene_152490 SARS-CoV-2 ORF8 protein Severe acute respiratory syndrome coronavirus 2 Ampicillin NCBI reference sequence: YP_009724396.1 Backbone Size:6080; Vector Backbone:pTwist_CMV_Puro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin wt 2026-09-19 02:10:59 0
pGBW-m4133990
 
Resource Report
Resource Website
RRID:Addgene_152424 SARS-CoV-2 nsp8 Severe acute respiratory syndrome coronavirus 2 Ampicillin NCBI reference sequence: YP_009725304.1 Backbone Size:6080; Vector Backbone:pTwist_CMV_Puro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin wt 2026-09-19 02:10:58 0
pBabe-Puro-RalA-S11A
 
Resource Report
Resource Website
RRID:Addgene_15253 v-ral simian leukemia viral oncogene homolog A Homo sapiens Ampicillin PMID:17540176 Backbone Size:5100; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin serine 11 to alanine 2026-09-19 02:11:00 0
pBabe-Puro-RalA-wt
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_15251 v-ral simian leukemia viral oncogene homolog A Homo sapiens Ampicillin PMID:17540176 Backbone Size:5100; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-09-19 02:10:59 1
pMKO.1-Puro-shPP2A-Abeta
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_15250 PP2A regulatory subunit A, beta isoform Homo sapiens Ampicillin PMID:17540176 Target sequence: CAACAATTGCCCTAGCACTTG Backbone Size:6700; Vector Backbone:pMKO.1; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin 2026-09-19 02:10:59 1
pGBW-m4134372
 
Resource Report
Resource Website
RRID:Addgene_152428 SARS-CoV-2 S (surface glycoprotein) Severe acute respiratory syndrome coronavirus 2 Ampicillin NCBI reference sequence: YP_009724390.1 Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin wt 2026-09-19 02:10:58 0
pGBW-m4133193
 
Resource Report
Resource Website
RRID:Addgene_152423 SARS-CoV-2 ORF8 protein Severe acute respiratory syndrome coronavirus 2 Ampicillin NCBI reference sequence: YP_009724396.1 Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin wt 2026-09-19 02:10:58 0
pGBW-m4134289
 
Resource Report
Resource Website
RRID:Addgene_152421 SARS-CoV-2 M (membrane) Severe acute respiratory syndrome coronavirus 2 Ampicillin NCBI reference sequence: YP_009724393.1 Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin wt 2026-09-19 02:10:58 0
pGBW-m4134013
 
Resource Report
Resource Website
RRID:Addgene_152420 SARS-CoV-2 ORF8 protein Severe acute respiratory syndrome coronavirus 2 Ampicillin NCBI reference sequence: YP_009724396.1 Backbone Size:6080; Vector Backbone:pTwist_CMV_Puro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin wt 2026-09-19 02:10:58 0
pGBW-m4134010
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_152437 SARS-CoV-2 nsp8 Severe acute respiratory syndrome coronavirus 2 Ampicillin NCBI reference sequence: YP_009725304.1 Backbone Size:6525; Vector Backbone:pTwist_CMV_Hygro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin wt 2026-09-19 02:10:58 1
pGBW-m4133147
 
Resource Report
Resource Website
RRID:Addgene_152435 SARS-CoV-2 nsp8 Severe acute respiratory syndrome coronavirus 2 Ampicillin NCBI reference sequence: YP_009725304.1 Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin wt 2026-09-19 02:10:58 0
pGBW-m4133366
 
Resource Report
Resource Website
RRID:Addgene_152439 SARS-CoV-2 3'-to-5' exonuclease Severe acute respiratory syndrome coronavirus 2 Ampicillin NCBI reference sequence: YP_009725309.1 Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin wt 2026-09-19 02:10:58 0
pGBW-m4133406
 
Resource Report
Resource Website
RRID:Addgene_152430 SARS-CoV-2 nsp8 Severe acute respiratory syndrome coronavirus 2 Ampicillin NCBI reference sequence: YP_009725304.1 Backbone Size:6525; Vector Backbone:pTwist_CMV_Hygro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin wt 2026-09-19 02:10:58 0
pGBW-m4133986
 
Resource Report
Resource Website
RRID:Addgene_152434 SARS-CoV-2 nsp9 Severe acute respiratory syndrome coronavirus 2 Ampicillin NCBI reference sequence: YP_009725305.1 Backbone Size:6080; Vector Backbone:pTwist_CMV_Puro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin wt 2026-09-19 02:10:58 0
pGBW-m4134200
 
Resource Report
Resource Website
RRID:Addgene_152433 SARS-CoV-2 3'-to-5' exonuclease Severe acute respiratory syndrome coronavirus 2 Ampicillin NCBI reference sequence: YP_009725309.1 Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin wt 2026-09-19 02:10:58 0
pGBW-m4134138
 
Resource Report
Resource Website
RRID:Addgene_152449 SARS-CoV-2 nsp10 Severe acute respiratory syndrome coronavirus 2 Ampicillin NCBI reference sequence: YP_009725306.1 Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin wt 2026-09-19 02:10:59 0
pGBW-m4133362
 
Resource Report
Resource Website
RRID:Addgene_152447 SARS-CoV-2 nsp2 Severe acute respiratory syndrome coronavirus 2 Ampicillin NCBI reference sequence: YP_009725298.1 Backbone Size:6080; Vector Backbone:pTwist_CMV_Puro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin wt 2026-09-19 02:10:59 0
pGBW-m4133214
 
Resource Report
Resource Website
RRID:Addgene_152446 SARS-CoV-2 endoRNAse Severe acute respiratory syndrome coronavirus 2 Ampicillin NCBI reference sequence: YP_009725310.1 Backbone Size:6525; Vector Backbone:pTwist_CMV_Hygro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin wt 2026-09-19 02:10:59 0
pGBW-m4134237
 
Resource Report
Resource Website
RRID:Addgene_152441 SARS-CoV-2 N (nucleocapsid) Severe acute respiratory syndrome coronavirus 2 Ampicillin NCBI reference sequence: YP_009724397.2 Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin wt 2026-09-19 02:10:59 0
pGBW-m4134387
 
Resource Report
Resource Website
RRID:Addgene_152445 SARS-CoV-2 helicase Severe acute respiratory syndrome coronavirus 2 Ampicillin NCBI reference sequence: YP_009725308.1 Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin wt 2026-09-19 02:10:59 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.