Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: v-ral simian leukemia viral oncogene homolog A
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540176
Proper citation: RRID:Addgene_15253 Copy
Species: Homo sapiens
Genetic Insert: v-ral simian leukemia viral oncogene homolog A
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540176
Proper citation: RRID:Addgene_15251 Copy
Species: Homo sapiens
Genetic Insert: PP2A regulatory subunit A, beta isoform
Vector Backbone Description: Backbone Size:6700; Vector Backbone:pMKO.1; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540176
Comments: Target sequence: CAACAATTGCCCTAGCACTTG
Proper citation: RRID:Addgene_15250 Copy
Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 S (surface glycoprotein)
Vector Backbone Description: Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009724390.1
Proper citation: RRID:Addgene_152428 Copy
Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 ORF8 protein
Vector Backbone Description: Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009724396.1
Proper citation: RRID:Addgene_152423 Copy
Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 M (membrane)
Vector Backbone Description: Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009724393.1
Proper citation: RRID:Addgene_152421 Copy
Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 ORF8 protein
Vector Backbone Description: Backbone Size:6080; Vector Backbone:pTwist_CMV_Puro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009724396.1
Proper citation: RRID:Addgene_152420 Copy
Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 nsp8
Vector Backbone Description: Backbone Size:6525; Vector Backbone:pTwist_CMV_Hygro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725304.1
Proper citation: RRID:Addgene_152437 Copy
Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 nsp8
Vector Backbone Description: Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725304.1
Proper citation: RRID:Addgene_152435 Copy
Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 3'-to-5' exonuclease
Vector Backbone Description: Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725309.1
Proper citation: RRID:Addgene_152439 Copy
Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 nsp8
Vector Backbone Description: Backbone Size:6525; Vector Backbone:pTwist_CMV_Hygro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725304.1
Proper citation: RRID:Addgene_152430 Copy
Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 nsp9
Vector Backbone Description: Backbone Size:6080; Vector Backbone:pTwist_CMV_Puro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725305.1
Proper citation: RRID:Addgene_152434 Copy
Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 3'-to-5' exonuclease
Vector Backbone Description: Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725309.1
Proper citation: RRID:Addgene_152433 Copy
Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 nsp10
Vector Backbone Description: Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725306.1
Proper citation: RRID:Addgene_152449 Copy
Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 nsp2
Vector Backbone Description: Backbone Size:6080; Vector Backbone:pTwist_CMV_Puro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725298.1
Proper citation: RRID:Addgene_152447 Copy
Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 endoRNAse
Vector Backbone Description: Backbone Size:6525; Vector Backbone:pTwist_CMV_Hygro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725310.1
Proper citation: RRID:Addgene_152446 Copy
Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 N (nucleocapsid)
Vector Backbone Description: Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009724397.2
Proper citation: RRID:Addgene_152441 Copy
Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 helicase
Vector Backbone Description: Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725308.1
Proper citation: RRID:Addgene_152445 Copy
Species: Homo sapiens
Genetic Insert: PP2A regulatory subunit A, alpha isoform
Vector Backbone Description: Backbone Size:6700; Vector Backbone:pMKO.1; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540176
Comments: Target sequence: GACAACAGCACCTTGCAGAGT
Proper citation: RRID:Addgene_15249 Copy
Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 nsp9
Vector Backbone Description: Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725305.1
Proper citation: RRID:Addgene_152459 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.