SYSTEM UPDATE: We will be performing system maintenace Saturday September 26 at 9pm to midnight Pacific Time

Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 457 showing 9121 ~ 9140 out of 743,073 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_15253

http://www.addgene.org/15253

Species: Homo sapiens
Genetic Insert: v-ral simian leukemia viral oncogene homolog A
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540176

Proper citation: RRID:Addgene_15253 Copy   


  • RRID:Addgene_15251

    This resource has 1+ mentions.

http://www.addgene.org/15251

Species: Homo sapiens
Genetic Insert: v-ral simian leukemia viral oncogene homolog A
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540176

Proper citation: RRID:Addgene_15251 Copy   


  • RRID:Addgene_15250

    This resource has 1+ mentions.

http://www.addgene.org/15250

Species: Homo sapiens
Genetic Insert: PP2A regulatory subunit A, beta isoform
Vector Backbone Description: Backbone Size:6700; Vector Backbone:pMKO.1; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540176
Comments: Target sequence: CAACAATTGCCCTAGCACTTG

Proper citation: RRID:Addgene_15250 Copy   


  • RRID:Addgene_152428

http://www.addgene.org/152428

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 S (surface glycoprotein)
Vector Backbone Description: Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009724390.1

Proper citation: RRID:Addgene_152428 Copy   


  • RRID:Addgene_152423

http://www.addgene.org/152423

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 ORF8 protein
Vector Backbone Description: Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009724396.1

Proper citation: RRID:Addgene_152423 Copy   


  • RRID:Addgene_152421

http://www.addgene.org/152421

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 M (membrane)
Vector Backbone Description: Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009724393.1

Proper citation: RRID:Addgene_152421 Copy   


  • RRID:Addgene_152420

http://www.addgene.org/152420

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 ORF8 protein
Vector Backbone Description: Backbone Size:6080; Vector Backbone:pTwist_CMV_Puro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009724396.1

Proper citation: RRID:Addgene_152420 Copy   


  • RRID:Addgene_152437

    This resource has 1+ mentions.

http://www.addgene.org/152437

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 nsp8
Vector Backbone Description: Backbone Size:6525; Vector Backbone:pTwist_CMV_Hygro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725304.1

Proper citation: RRID:Addgene_152437 Copy   


  • RRID:Addgene_152435

http://www.addgene.org/152435

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 nsp8
Vector Backbone Description: Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725304.1

Proper citation: RRID:Addgene_152435 Copy   


  • RRID:Addgene_152439

http://www.addgene.org/152439

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 3'-to-5' exonuclease
Vector Backbone Description: Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725309.1

Proper citation: RRID:Addgene_152439 Copy   


  • RRID:Addgene_152430

http://www.addgene.org/152430

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 nsp8
Vector Backbone Description: Backbone Size:6525; Vector Backbone:pTwist_CMV_Hygro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725304.1

Proper citation: RRID:Addgene_152430 Copy   


  • RRID:Addgene_152434

http://www.addgene.org/152434

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 nsp9
Vector Backbone Description: Backbone Size:6080; Vector Backbone:pTwist_CMV_Puro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725305.1

Proper citation: RRID:Addgene_152434 Copy   


  • RRID:Addgene_152433

http://www.addgene.org/152433

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 3'-to-5' exonuclease
Vector Backbone Description: Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725309.1

Proper citation: RRID:Addgene_152433 Copy   


  • RRID:Addgene_152449

http://www.addgene.org/152449

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 nsp10
Vector Backbone Description: Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725306.1

Proper citation: RRID:Addgene_152449 Copy   


  • RRID:Addgene_152447

http://www.addgene.org/152447

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 nsp2
Vector Backbone Description: Backbone Size:6080; Vector Backbone:pTwist_CMV_Puro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725298.1

Proper citation: RRID:Addgene_152447 Copy   


  • RRID:Addgene_152446

http://www.addgene.org/152446

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 endoRNAse
Vector Backbone Description: Backbone Size:6525; Vector Backbone:pTwist_CMV_Hygro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725310.1

Proper citation: RRID:Addgene_152446 Copy   


  • RRID:Addgene_152441

http://www.addgene.org/152441

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 N (nucleocapsid)
Vector Backbone Description: Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009724397.2

Proper citation: RRID:Addgene_152441 Copy   


  • RRID:Addgene_152445

http://www.addgene.org/152445

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 helicase
Vector Backbone Description: Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725308.1

Proper citation: RRID:Addgene_152445 Copy   


  • RRID:Addgene_15249

    This resource has 1+ mentions.

http://www.addgene.org/15249

Species: Homo sapiens
Genetic Insert: PP2A regulatory subunit A, alpha isoform
Vector Backbone Description: Backbone Size:6700; Vector Backbone:pMKO.1; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540176
Comments: Target sequence: GACAACAGCACCTTGCAGAGT

Proper citation: RRID:Addgene_15249 Copy   


  • RRID:Addgene_152459

http://www.addgene.org/152459

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 nsp9
Vector Backbone Description: Backbone Size:4180; Vector Backbone:pTwist_CMV_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725305.1

Proper citation: RRID:Addgene_152459 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X