Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
FAMApro_XVE_DBox_SCFP3A_PH7 Resource Report Resource Website |
RRID:Addgene_257230 | FAMApro_XVE_DBox_SCFP3A | Arabidopsis thaliana | Spectinomycin | PMID:41693245 | Vector Backbone:pH7m34GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | 2026-08-29 01:27:46 | 0 | ||
|
pAJE-30-Mj-nitroY Resource Report Resource Website |
RRID:Addgene_249488 | 3-nitrotyrosine RS (A7) | M. jannaschii | Spectinomycin | PMID:42037767 | 3-nitrotyrosine RS (A7) insert is the same found on Plasmid #174079, the difference being the all-compatible pAJE origin. | Backbone Size:5943; Vector Backbone:pAJE; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin | Y32H H70T D158H I159A L162R | 2026-08-29 01:27:47 | 0 |
|
pAJE-30-Ma-nitroY Resource Report Resource Website |
RRID:Addgene_249487 | 3-nitrotyrosine RS (F5) | M. alvus | Spectinomycin | PMID:42037767 | 3-nitrotyrosine RS (F5) insert is the same as Plasmid #225684, the difference being the low-copy pAJE origin (B95 cell compatible). | Backbone Size:3220; Vector Backbone:pAJE; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin | N166A, V168S, A223C, W239R | 2026-08-29 01:27:47 | 0 |
|
pCS10 Resource Report Resource Website |
RRID:Addgene_253620 | FLP recombinase | Spectinomycin | Alternative name: pRC453 Usage/Comments: This plasmid is used to generate a cSAGE-compatible base strain. Once pSC01 is integrated into the chromosome, this plasmid expresses FLP recombinase to cure / excise the backbone marker and contains a SacB marker for sucrose counterselection. This plasmid is used only for installation of the landing pad and is not required for downstream integration steps after the base strain is constructed. Please visit https://doi.org/10.64898/2026.04.17.717921 for bioRxiv preprint. | Vector Backbone:pBBR1; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin | 2026-08-29 01:27:54 | 0 | |||
|
BdCESA8::LUC Resource Report Resource Website |
RRID:Addgene_256446 | Luciferase | Firefly | Spectinomycin | PMID:40236254 | Please visit https://doi.org/10.1101/2025.04.03.647122 for bioRxiv preprint. | Vector Backbone:pIPKb001; Vector Types:Luciferase; Bacterial Resistance:Spectinomycin | 2026-08-29 01:27:54 | 0 | |
|
BdPMT::LUC Resource Report Resource Website |
RRID:Addgene_256447 | Luciferase | Firefly | Spectinomycin | PMID:40236254 | Please visit https://doi.org/10.1101/2025.04.03.647122 for bioRxiv preprint. | Vector Backbone:pIPKb001; Vector Types:Luciferase; Bacterial Resistance:Spectinomycin | 2026-08-29 01:27:54 | 0 | |
|
pSPIN-GG Resource Report Resource Website |
RRID:Addgene_251750 | Spectinomycin | PMID:42420722 | Backbone Size:13712; Vector Backbone:pSC101*; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Spectinomycin | 2026-08-29 01:27:55 | 0 | ||||
|
pDGB3omega1_[10x 2EBS-S10:35Smp:NLS:YPet:35Sterm]-[tNOS:BASTA:pNOS] Resource Report Resource Website |
RRID:Addgene_254064 | 10x 2EBS-S10:35Smp:NLS:YPet:35Sterm | Synthetic | Spectinomycin | PMID:38379432 | Vector Backbone:pDGB3omega1; Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin | 2026-08-29 01:27:56 | 0 | ||
|
pART27::PtGFP Resource Report Resource Website |
RRID:Addgene_258579 | PtGFP | Ptilosarcus sp. CSG-2001 | Spectinomycin | PMID:16600023 | pART27::PtGFP is the binary vector harbouring the NotI-fragment subcloned from pART7::PtGFP. It is for stable expression of PtGFP in the cytoplasm of higher plants via agrobacterium mediated transfer of the tDNA into the plant genome (Clough and Bent 1998 PubMed: 10069079; DOI: 10.1007/BF00028910). Note: The vector confers Spectinomycin resistance to bacteria (E. coli and Agrobacterium tumefaciens), but confers Kanamycin resistance to plants. PtGFP (GenBank AY015995) is a green fluorescent protein from the sea pen Ptilosarcus gurneyi which has been expressed in plants and used as a ratiometric pH indicator (Schulte et al. 2006 doi.org/10.1186/1746-4811-2-7, PubMed ID: 16600023). PtGFP is more photostable and less sensitive to acidic environments when compared with pHluorins (GenBank AF058694; GenBank AF058695). | Backbone Marker:Andrew Gleave (Addgene #247986); Backbone Size:11612; Vector Backbone:pART27; Vector Types:Bacterial Expression, Plant Expression; Bacterial Resistance:Spectinomycin | 2026-08-29 01:27:55 | 0 | |
|
pDGB3omega2_[10x 2EBS-S10:35Smp:NLS:GUS:35Sterm]-[tNOS:BASTA:pNOS] Resource Report Resource Website |
RRID:Addgene_254066 | 10x 2EBS-S10:35Smp:NLS:GUS:35Sterm | Synthetic | Spectinomycin | PMID:38379432 | Vector Backbone:pDGB3omega2; Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin | 2026-08-29 01:26:59 | 0 | ||
|
pDGB3omega2_[tNOS:BASTA:pNOS]-[EBSn:35Smp:GUS-(ggggs)x2-1x YPet:35Sterm] Resource Report Resource Website |
RRID:Addgene_254069 | EBSn:35Smp:GUS-(ggggs)x2-1x YPet:35Sterm | Synthetic | Spectinomycin | PMID:40976865 | Vector Backbone:pDGB3omega2; Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin | 2026-08-29 01:26:59 | 0 | ||
|
pZZ006-AlcA::DM2h[Bla-1] S111A H112A-Myc Resource Report Resource Website |
RRID:Addgene_246382 | DM2h[Bla-1] | Arabidopsis thaliana | Spectinomycin | Vector Backbone:pZZ006; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | CCATTCTTAGTCACATCCTCGAA to AAAACCATTCTTGCTGCTATCCTCGAA amino acid S111A H112A | 2026-08-29 01:27:02 | 0 | ||
|
pSH1 Resource Report Resource Website |
RRID:Addgene_254170 | Spectinomycin | PMID:41967643 | Vector Backbone:PZP200; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | 2026-08-29 01:27:08 | 0 | ||||
|
pSH6 Resource Report Resource Website |
RRID:Addgene_254178 | Spectinomycin | PMID:41967643 | Vector Backbone:PZP200; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | 2026-08-29 01:27:06 | 0 | ||||
|
pSH9 Resource Report Resource Website |
RRID:Addgene_254181 | Spectinomycin | PMID:41967643 | Vector Backbone:PZP200; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | 2026-08-29 01:27:06 | 0 | ||||
|
pSH11 Resource Report Resource Website |
RRID:Addgene_254183 | Spectinomycin | PMID:41967643 | Vector Backbone:PZP200; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | 2026-08-29 01:27:06 | 0 | ||||
|
pENTR223-FDX1 Resource Report Resource Website |
RRID:Addgene_251696 | FDX1 ferredoxin 1 | Homo sapiens | Spectinomycin | PMID:40215978 | Backbone Size:2815; Vector Backbone:pENTR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin | 2026-08-29 01:26:21 | 0 | ||
|
pCA0.325 Resource Report Resource Website |
RRID:Addgene_200622 | Spectinomycin | Operon building system compatible with the CyanoGate Kit. McCormick Lab also uses TOP10 cells for transformation. | Vector Backbone:pL0-SC; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin | 2026-08-29 01:26:22 | 0 | ||||
|
pC0.340 Resource Report Resource Website |
RRID:Addgene_200628 | RBS* | Synthetic | Spectinomycin | McCormick Lab also uses TOP10 cells for transformation. | Vector Backbone:pL0-SC; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin | 2026-08-29 01:26:22 | 0 | ||
|
pC0.341 Resource Report Resource Website |
RRID:Addgene_200629 | RBS_B0034 | Synthetic | Spectinomycin | McCormick Lab also uses TOP10 cells for transformation. | Vector Backbone:pL0-SC; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin | 2026-08-29 01:26:22 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.