Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:spectinomycin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

17,900 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
FAMApro_XVE_DBox_SCFP3A_PH7
 
Resource Report
Resource Website 		RRID:Addgene_257230 FAMApro_XVE_DBox_SCFP3A Arabidopsis thaliana Spectinomycin PMID:41693245 Vector Backbone:pH7m34GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin 2026-08-29 01:27:46 0
pAJE-30-Mj-nitroY
 
Resource Report
Resource Website 		RRID:Addgene_249488 3-nitrotyrosine RS (A7) M. jannaschii Spectinomycin PMID:42037767 3-nitrotyrosine RS (A7) insert is the same found on Plasmid #174079, the difference being the all-compatible pAJE origin. Backbone Size:5943; Vector Backbone:pAJE; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin Y32H H70T D158H I159A L162R 2026-08-29 01:27:47 0
pAJE-30-Ma-nitroY
 
Resource Report
Resource Website 		RRID:Addgene_249487 3-nitrotyrosine RS (F5) M. alvus Spectinomycin PMID:42037767 3-nitrotyrosine RS (F5) insert is the same as Plasmid #225684, the difference being the low-copy pAJE origin (B95 cell compatible). Backbone Size:3220; Vector Backbone:pAJE; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin N166A, V168S, A223C, W239R 2026-08-29 01:27:47 0
pCS10
 
Resource Report
Resource Website 		RRID:Addgene_253620 FLP recombinase Spectinomycin Alternative name: pRC453 Usage/Comments: This plasmid is used to generate a cSAGE-compatible base strain. Once pSC01 is integrated into the chromosome, this plasmid expresses FLP recombinase to cure / excise the backbone marker and contains a SacB marker for sucrose counterselection. This plasmid is used only for installation of the landing pad and is not required for downstream integration steps after the base strain is constructed. Please visit https://doi.org/10.64898/2026.04.17.717921 for bioRxiv preprint. Vector Backbone:pBBR1; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin 2026-08-29 01:27:54 0
BdCESA8::LUC
 
Resource Report
Resource Website 		RRID:Addgene_256446 Luciferase Firefly Spectinomycin PMID:40236254 Please visit https://doi.org/10.1101/2025.04.03.647122 for bioRxiv preprint. Vector Backbone:pIPKb001; Vector Types:Luciferase; Bacterial Resistance:Spectinomycin 2026-08-29 01:27:54 0
BdPMT::LUC
 
Resource Report
Resource Website 		RRID:Addgene_256447 Luciferase Firefly Spectinomycin PMID:40236254 Please visit https://doi.org/10.1101/2025.04.03.647122 for bioRxiv preprint. Vector Backbone:pIPKb001; Vector Types:Luciferase; Bacterial Resistance:Spectinomycin 2026-08-29 01:27:54 0
pSPIN-GG
 
Resource Report
Resource Website 		RRID:Addgene_251750 Spectinomycin PMID:42420722 Backbone Size:13712; Vector Backbone:pSC101*; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Spectinomycin 2026-08-29 01:27:55 0
pDGB3omega1_[10x 2EBS-S10:35Smp:NLS:YPet:35Sterm]-[tNOS:BASTA:pNOS]
 
Resource Report
Resource Website 		RRID:Addgene_254064 10x 2EBS-S10:35Smp:NLS:YPet:35Sterm Synthetic Spectinomycin PMID:38379432 Vector Backbone:pDGB3omega1; Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin 2026-08-29 01:27:56 0
pART27::PtGFP
 
Resource Report
Resource Website 		RRID:Addgene_258579 PtGFP Ptilosarcus sp. CSG-2001 Spectinomycin PMID:16600023 pART27::PtGFP is the binary vector harbouring the NotI-fragment subcloned from pART7::PtGFP. It is for stable expression of PtGFP in the cytoplasm of higher plants via agrobacterium mediated transfer of the tDNA into the plant genome (Clough and Bent 1998 PubMed: 10069079; DOI: 10.1007/BF00028910). Note: The vector confers Spectinomycin resistance to bacteria (E. coli and Agrobacterium tumefaciens), but confers Kanamycin resistance to plants. PtGFP (GenBank AY015995) is a green fluorescent protein from the sea pen Ptilosarcus gurneyi which has been expressed in plants and used as a ratiometric pH indicator (Schulte et al. 2006 doi.org/10.1186/1746-4811-2-7, PubMed ID: 16600023). PtGFP is more photostable and less sensitive to acidic environments when compared with pHluorins (GenBank AF058694; GenBank AF058695). Backbone Marker:Andrew Gleave (Addgene #247986); Backbone Size:11612; Vector Backbone:pART27; Vector Types:Bacterial Expression, Plant Expression; Bacterial Resistance:Spectinomycin 2026-08-29 01:27:55 0
pDGB3omega2_[10x 2EBS-S10:35Smp:NLS:GUS:35Sterm]-[tNOS:BASTA:pNOS]
 
Resource Report
Resource Website 		RRID:Addgene_254066 10x 2EBS-S10:35Smp:NLS:GUS:35Sterm Synthetic Spectinomycin PMID:38379432 Vector Backbone:pDGB3omega2; Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin 2026-08-29 01:26:59 0
pDGB3omega2_[tNOS:BASTA:pNOS]-[EBSn:35Smp:GUS-(ggggs)x2-1x YPet:35Sterm]
 
Resource Report
Resource Website 		RRID:Addgene_254069 EBSn:35Smp:GUS-(ggggs)x2-1x YPet:35Sterm Synthetic Spectinomycin PMID:40976865 Vector Backbone:pDGB3omega2; Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin 2026-08-29 01:26:59 0
pZZ006-AlcA::DM2h[Bla-1] S111A H112A-Myc
 
Resource Report
Resource Website 		RRID:Addgene_246382 DM2h[Bla-1] Arabidopsis thaliana Spectinomycin Vector Backbone:pZZ006; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin CCATTCTTAGTCACATCCTCGAA to AAAACCATTCTTGCTGCTATCCTCGAA amino acid S111A H112A 2026-08-29 01:27:02 0
pSH1
 
Resource Report
Resource Website 		RRID:Addgene_254170 Spectinomycin PMID:41967643 Vector Backbone:PZP200; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin 2026-08-29 01:27:08 0
pSH6
 
Resource Report
Resource Website 		RRID:Addgene_254178 Spectinomycin PMID:41967643 Vector Backbone:PZP200; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin 2026-08-29 01:27:06 0
pSH9
 
Resource Report
Resource Website 		RRID:Addgene_254181 Spectinomycin PMID:41967643 Vector Backbone:PZP200; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin 2026-08-29 01:27:06 0
pSH11
 
Resource Report
Resource Website 		RRID:Addgene_254183 Spectinomycin PMID:41967643 Vector Backbone:PZP200; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin 2026-08-29 01:27:06 0
pENTR223-FDX1
 
Resource Report
Resource Website 		RRID:Addgene_251696 FDX1 ferredoxin 1 Homo sapiens Spectinomycin PMID:40215978 Backbone Size:2815; Vector Backbone:pENTR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin 2026-08-29 01:26:21 0
pCA0.325
 
Resource Report
Resource Website 		RRID:Addgene_200622 Spectinomycin Operon building system compatible with the CyanoGate Kit. McCormick Lab also uses TOP10 cells for transformation. Vector Backbone:pL0-SC; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin 2026-08-29 01:26:22 0
pC0.340
 
Resource Report
Resource Website 		RRID:Addgene_200628 RBS* Synthetic Spectinomycin McCormick Lab also uses TOP10 cells for transformation. Vector Backbone:pL0-SC; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin 2026-08-29 01:26:22 0
pC0.341
 
Resource Report
Resource Website 		RRID:Addgene_200629 RBS_B0034 Synthetic Spectinomycin McCormick Lab also uses TOP10 cells for transformation. Vector Backbone:pL0-SC; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin 2026-08-29 01:26:22 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch