Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:ampicillin and kanamycin (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

1,969 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pRRG1014-LDLRR-3
 
Resource Report
Resource Website
RRID:Addgene_99095 LDLRR-3 in situ probe Schmidtea mediterranea Ampicillin and Kanamycin PMID:27612384 Cloning primers: F-GATGTTTAGACCATAGTATATG, R-GAATTGAAGATAAAATAAATTG Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:22:44 0
pRRG142-Arrowhead
 
Resource Report
Resource Website
RRID:Addgene_99097 Arrowhead in situ probe Schmidtea mediterranea Ampicillin and Kanamycin PMID:27612384 Cloning primers: F-TTGATGGAAAGTGTTTTGGTTG, R-TTTTCAGTTTTCCCGTTACAAA Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:22:43 0
pCRISPR01-FnCpf1
 
Resource Report
Resource Website
RRID:Addgene_176529 FnCpf1 Synthetic Ampicillin and Kanamycin PMID:33573639 Backbone Marker:Uffe Mortensen (Addgene plasmid # 87844); Vector Backbone:pFC333; Vector Types:CRISPR, Fungal Expression; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:22:57 0
pRRG581-FLI1
 
Resource Report
Resource Website
RRID:Addgene_99099 FLI-1 in situ probe Schmidtea mediterranea Ampicillin and Kanamycin PMID:27612384 Cloning primers: F-CGGACTTGGACTATCGGAAA, R-CCACAGTACCGGCATGATTA Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:22:43 0
pRRG290-IF1
 
Resource Report
Resource Website
RRID:Addgene_99100 IF-1 in situ probe Schmidtea mediterranea Ampicillin and Kanamycin PMID:27612384 Cloning primers: F-AATGAATTGTCCGCTCTTGC, R-TGAATTATTGAATCGGCTTCTG Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:22:43 0
pRRG370-GS1
 
Resource Report
Resource Website
RRID:Addgene_99101 GS-1 in situ probe Schmidtea mediterranea Ampicillin and Kanamycin PMID:27612384 Cloning primers: F-ATCATCCATGGTTTGGCATT, R-CGTCCGGTTAAACGATGTCT Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:22:44 0
pRRG796-jagged-like
 
Resource Report
Resource Website
RRID:Addgene_99103 jagged-like in situ probe Schmidtea mediterranea Ampicillin and Kanamycin PMID:27612384 Cloning primers: F-AAAAACCGATAGTCGAAAGC, R-ATCGTCAACTTTTTCGGAAT Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:22:43 0
H11-CAG-loxP-FNF-bpA-3pA-loxP-tdTomato
 
Resource Report
Resource Website
RRID:Addgene_180156 tdTomato Synthetic Ampicillin and Kanamycin A reporter expression cassette with short homology arms to Hipp11 on either side. Constructed originally for generating Hipp11 reporter allele targeting vector by recombineering. Untested for other purposes, but may be useful for CRISPR knock-in as well. Backbone Marker:Hyung-song Nam, Capecchi laboratory; Vector Backbone:Custom; Vector Types:Mammalian Expression, Bacterial Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:22:50 0
pCAT.000
 
Resource Report
Resource Website
RRID:Addgene_119559 Ampicillin and Kanamycin PMID:30819783 Please visit https://www.biorxiv.org/content/10.1101/426700v1 for bioRxiv preprint. Vector Backbone:pPMQAK1; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:03:14 0
6377 H10-104b
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_1248 Hsp104 Saccharomyces cerevisiae Ampicillin and Kanamycin PMID:9674429 Backbone Size:0; Vector Backbone:pJC45S; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:04:09 4
pHybr_r2a>Fab-srt-his
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_124810 rat IgG2a Hinge-G4S-Sortag-Histag Rattus norvegicus Ampicillin and Kanamycin PMID:31489367 Backbone Marker:Thermo Fisher; Backbone Size:3956; Vector Backbone:pCR4 TOPO TA; Vector Types:Bacterial Expression, CRISPR, HDR template; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:04:09 1
LSB-hsa-miR-92a-1-5p
 
Resource Report
Resource Website
RRID:Addgene_103750 hsa-miR-92a-1-5p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:00:36 0
LSB-hsa-miR-93-5p
 
Resource Report
Resource Website
RRID:Addgene_103756 hsa-miR-93-5p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:00:36 0
LSB-hsa-miR-942-5p
 
Resource Report
Resource Website
RRID:Addgene_103759 hsa-miR-942-5p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:00:36 0
LSB-hsa-miR-92a-3p
 
Resource Report
Resource Website
RRID:Addgene_103752 hsa-miR-92a-3p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:00:36 0
LSB-hsa-miR-93-3p
 
Resource Report
Resource Website
RRID:Addgene_103755 hsa-miR-93-3p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:00:36 0
LSB-hsa-miR-96-3p
 
Resource Report
Resource Website
RRID:Addgene_103760 hsa-miR-96-3p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:00:37 0
LSB-hsa-miR-98-3p
 
Resource Report
Resource Website
RRID:Addgene_103762 hsa-miR-98-3p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:00:36 0
LSB-hsa-miR-99a-3p
 
Resource Report
Resource Website
RRID:Addgene_103764 hsa-miR-99a-3p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:00:36 0
LSB-hsa-miR-98-5p
 
Resource Report
Resource Website
RRID:Addgene_103763 hsa-miR-98-5p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:00:37 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.