Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 45 showing 881 ~ 900 out of 1,969 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_86461

http://www.addgene.org/86461

Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4500; Vector Backbone:pGL4.23; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27708057
Comments: Use FspI and AclI to remove the kanamycin resistance cassette and replace with putative regulatory elements by Gibson cloning.

Proper citation: RRID:Addgene_86461 Copy   


http://www.addgene.org/61069

Species: Synthetic
Genetic Insert: eGFPbait
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCRII-TOPO; Vector Types:zebrafish expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:24179142
Comments: The eGFPbait-E2A-KalTA4 donor plasmid was generated by forward insertion of a PCR-amplified eGFP fragment into the pCRII-TOPO vector. Primers used were eGFP_fwd: ATAGTGGTACCATGGTGAGCAAGGGCGAGGAGC, and eGFP_rev: GTAGCGGCTGAAGCACTGCACGC. The E2A-KalTA4-pA fragment was generated by fusion of individual PCR products using Phusion High-Fidelity DNA Polymerase (Thermo Scientific); E2A was amplified with the primers E2A_fwd: TGCAGATATCCAGGAGGAGGACAGTGTACTAATTATGCTC, E2A_rev: TTCCTCCTCCGGGACCTGGGTTGCTC from a previously generated E2A sequence (Szymczak et al. 2004, PMID 15064769). KalTA4-pA was amplified with KalTA4_fwd: CCCAGGTCCCGGAGGAGGAAAACTGCTC, KalTA4_rev: CATGCTCGAGTCCACTAGTTCTAGAGCG, using the 4 × Kaloop vector as template (Distel et al. 2009, PMID 19628697). Subsequently, both fragments were fused, amplified, and inserted into pCRII-TOPO-eGFPbait with EcoRV and XhoI.

Proper citation: RRID:Addgene_61069 Copy   


  • RRID:Addgene_61518

    This resource has 1+ mentions.

http://www.addgene.org/61518

Species: Homo sapiens
Genetic Insert: NEAT1
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:4000; Vector Backbone:PCRII; Vector Types:general cloning vector; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:19217333
Comments: *To create this plasmid, hNEAT1 was amplified from HeLa cDNA. The insert contains two mismatches (C->T at bp 78, and A->G at bp 91, an A->G at bp 1666, and a deletion of TA at bp 2031 and 2032 using the numbering of NR_028272.1) compared to the canonical hNEAT1 sequence. These variants are likely to be encoded in the HeLa genome, as they appeared in multiple clones, but this is yet to be verified by sequencing of HeLa genomic DNA.

Proper citation: RRID:Addgene_61518 Copy   


  • RRID:Addgene_61601

    This resource has 1+ mentions.

http://www.addgene.org/61601

Genetic Insert: Kana_I-SceI
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:16526409

Proper citation: RRID:Addgene_61601 Copy   


  • RRID:Addgene_80820

    This resource has 1+ mentions.

http://www.addgene.org/80820

Species: Synthetic
Genetic Insert: 3xFLAG-piggyBac-DsRed
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR™4-TOPO; Vector Types:Unspecified; Bacterial Resistance:Ampicillin and Kanamycin

Proper citation: RRID:Addgene_80820 Copy   


http://www.addgene.org/81114

Species: Caenorhabditis elegans
Genetic Insert: sls-1.2
Vector Backbone Description: Backbone Marker:Transgen; Backbone Size:3830; Vector Backbone:pEASY-Blunt Simple Cloning Vector; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27557708

Proper citation: RRID:Addgene_81114 Copy   


  • RRID:Addgene_187879

http://www.addgene.org/187879

Vector Backbone Description: Backbone Marker:Stratagene (Agilent Tech); Backbone Size:2864; Vector Backbone:pBluescript KS(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:35416085

Proper citation: RRID:Addgene_187879 Copy   


  • RRID:Addgene_99092

http://www.addgene.org/99092

Species: Schmidtea mediterranea
Genetic Insert: CRELD in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27612384
Comments: Cloning primers: F-AAAAATTGTGCCCATCTTCG, R-TGATTCCATCCTTCAGCACA

Proper citation: RRID:Addgene_99092 Copy   


  • RRID:Addgene_99071

http://www.addgene.org/99071

Species: Schmidtea mediterranea
Genetic Insert: sFRP1 (secreted frizzled related protein 1) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191
Comments: Cloning primers: F-AAACACTCAATGCCATGTCG, R-GTTGTCGCTGTCGATTTGTG

Proper citation: RRID:Addgene_99071 Copy   


  • RRID:Addgene_99074

http://www.addgene.org/99074

Species: Schmidtea mediterranea
Genetic Insert: Smedwi-1 in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191
Comments: Cloning primers: F-CGTTCCTAAAGGCACAGCTC, R-TTGGATTAGCCCCATCTTTG

Proper citation: RRID:Addgene_99074 Copy   


  • RRID:Addgene_99073

http://www.addgene.org/99073

Species: Schmidtea mediterranea
Genetic Insert: Wnt1 (also known as WntP-1) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191
Comments: Cloning primers: F-AATCATCGCTGGAACTGTCC, R-TGTGGCAAATTTTGGTCGTA

Proper citation: RRID:Addgene_99073 Copy   


  • RRID:Addgene_99075

http://www.addgene.org/99075

Species: Schmidtea mediterranea
Genetic Insert: Activin (also known as activin 2) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191
Comments: Cloning primers: F-GGCCTTTGAAAGAACAGTGG, R-CTTCCTCGAGCGAAATTCAG

Proper citation: RRID:Addgene_99075 Copy   


  • RRID:Addgene_99078

http://www.addgene.org/99078

Species: Schmidtea mediterranea
Genetic Insert: Smad2/3 in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191
Comments: Cloning primers: F-CATGGAAACAAGCATTGTGG, R-GGTGGGATCTTGCAAACTGT

Proper citation: RRID:Addgene_99078 Copy   


  • RRID:Addgene_99079

http://www.addgene.org/99079

Species: Schmidtea mediterranea
Genetic Insert: Ras-related (also known as h.18.4a) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191
Comments: Cloning primers: F-TGTGCGCTATCGTCAAAAAG, R-TTGAGATTACGAAGTCGACGAA

Proper citation: RRID:Addgene_99079 Copy   


  • RRID:Addgene_99081

    This resource has 1+ mentions.

http://www.addgene.org/99081

Species: Schmidtea mediterranea
Genetic Insert: Cyp1A1 (also known as h.49.4f) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191
Comments: Cloning primers: F-TTGAAATTGGAGCGAAAATTAAA, R-GGGGAAATTCTTGAACCCTTC Note: The Cyp1A1 insert contains several mismatches compared to AY067980.1. The depositor has confirmed this does not impact plasmid function.

Proper citation: RRID:Addgene_99081 Copy   


  • RRID:Addgene_99085

http://www.addgene.org/99085

Species: Other
Genetic Insert: eyes absent (eya)
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191

Proper citation: RRID:Addgene_99085 Copy   


  • RRID:Addgene_99087

http://www.addgene.org/99087

Species: Other
Genetic Insert: prohormone convertase 2 (PC2)
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191
Comments: Cloning primers: F-TCGTTGCACACCTGTACCAT, R-CACTCCAACACCACAAATGC

Proper citation: RRID:Addgene_99087 Copy   


  • RRID:Addgene_99086

http://www.addgene.org/99086

Species: Schmidtea mediterranea
Genetic Insert: soxB (also known as soxB1-1) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191
Comments: Cloning primers: F-TACTCATCCGCCCTTTCATC, R-CCGATCAATGTCTTCGGACT

Proper citation: RRID:Addgene_99086 Copy   


  • RRID:Addgene_99088

http://www.addgene.org/99088

Species: Schmidtea mediterranea
Genetic Insert: SoxB2-2 in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27612384
Comments: Cloning primers: F-CGGTTACAGCGATGAAGACA, R-GAGAGTGACGGCAGAGTTCC

Proper citation: RRID:Addgene_99088 Copy   


  • RRID:Addgene_99090

http://www.addgene.org/99090

Species: Schmidtea mediterranea
Genetic Insert: Hesl-3 (hes-like) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27612384
Comments: Cloning primers: F-GGCAGAGCTCAAAGAATTGG, R-AACGGCCAGCTTTAGGATTT

Proper citation: RRID:Addgene_99090 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X