Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: T1, gRNA scaffold, OsU3t plus, TaU3p, T2
Vector Backbone Description: Vector Backbone:pGWC; Vector Types:Plant Expression, CRISPR, PCR template; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:25432517
Comments: Please note that this plasmid runs as a dimer (>7kb) or multimer.
Proper citation: RRID:Addgene_50593 Copy
Species: Synthetic
Genetic Insert: T3, gRNA scaffold, U6-26t plus, OsU3p, T4
Vector Backbone Description: Vector Backbone:pGWC; Vector Types:Plant Expression, CRISPR, PCR template; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:25432517
Proper citation: RRID:Addgene_50595 Copy
Species: Synthetic
Genetic Insert: T1, U626t plus, U629p, T2
Vector Backbone Description: Vector Backbone:pGWC; Vector Types:Plant Expression, CRISPR, PCR template; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:25432517
Proper citation: RRID:Addgene_50590 Copy
Species: Synthetic
Genetic Insert: T3, gRNA scaffold, U6-1tplus, U6-26p, T4
Vector Backbone Description: Vector Backbone:pGWC; Vector Types:Plant Expression, CRISPR, PCR template; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:25432517
Proper citation: RRID:Addgene_50592 Copy
Species: Synthetic
Genetic Insert: 3xGFP
Vector Backbone Description: Vector Backbone:pBS; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12566428
Comments: Please note that this plasmid is unstable due to the tandem yeGFP genes. Screening of colonies is required prior to storage. See diagnostic digest for expected results.
Proper citation: RRID:Addgene_50659 Copy
Species: Synthetic
Genetic Insert: rTetR DNA binding domain-GBP1 fusion protein
Vector Backbone Description: Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23953120
Comments: Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.
Proper citation: RRID:Addgene_50791 Copy
Species: Synthetic
Genetic Insert: two-copy Pyl tRNA cassette
Vector Backbone Description: Vector Backbone:pAcBac; Vector Types:Insect Expression, baculoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23818609
Proper citation: RRID:Addgene_50832 Copy
Species: Synthetic
Genetic Insert: GBP6-VPminx4 activation domain fusion protein
Vector Backbone Description: Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23953120
Comments: Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.
Note that GBP6 was verified in Addgene's quality control sequencing but cannot be displayed.
Proper citation: RRID:Addgene_50796 Copy
Species: Synthetic
Genetic Insert: two-copy Tyr tRNA cassette
Vector Backbone Description: Vector Backbone:pAcBac; Vector Types:Insect Expression, baculoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23818609
Proper citation: RRID:Addgene_50831 Copy
Species: Synthetic
Genetic Insert: split EGFP
Vector Backbone Description: Backbone Size:5138; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24284873
Proper citation: RRID:Addgene_50716 Copy
Species: Synthetic
Genetic Insert: ddRFP A and ddRFP B
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25622108
Comments: There is a small discrepancy between the reference sequence and Addgene's quality control sequence, this causes an A to G mutation in the linker region between NLS and ddRFP B. This change should not affect plasmid function.
Proper citation: RRID:Addgene_50840 Copy
Species: Synthetic
Genetic Insert: ddGFP A and ddGFP B
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25622108
Proper citation: RRID:Addgene_50842 Copy
Species: Synthetic
Genetic Insert: ddRFP A and ddRFP B
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25622108
Proper citation: RRID:Addgene_50849 Copy
Species: Synthetic
Genetic Insert: ddGFP A
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25622108
Proper citation: RRID:Addgene_50852 Copy
Species: synthetic
Genetic Insert: negative control sgRNA
Vector Backbone Description: Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24346702
Comments: Please note that Addgene's diagnostic digest results suggest that the backbone may be longer than suggested.
Proper citation: RRID:Addgene_50927 Copy
Species: Synthetic
Genetic Insert: hSpCas9
Vector Backbone Description: Vector Backbone:PX458; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24157548
Comments: For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/.
Proper citation: RRID:Addgene_48138 Copy
Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pX335 (Addgene #42335); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23979020
Comments: Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT
For more information including protocols and
updates, please go to http://www.crispr-on.org
Proper citation: RRID:Addgene_48238 Copy
Species: Synthetic
Genetic Insert: EYFP
Vector Backbone Description: Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2655; Vector Backbone:pDONRP4-P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23957834
Proper citation: RRID:Addgene_48350 Copy
Species: Synthetic
Genetic Insert: EGFP
Vector Backbone Description: Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2655; Vector Backbone:pDONRP4-P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23957834
Proper citation: RRID:Addgene_48348 Copy
Species: Synthetic
Genetic Insert: mKate2
Vector Backbone Description: Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2639; Vector Backbone:pDONRP2R-P3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23957834
Proper citation: RRID:Addgene_48345 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.