Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pCBC-MT1T2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_50593 | T1, gRNA scaffold, OsU3t plus, TaU3p, T2 | Synthetic | Chloramphenicol | PMID:25432517 | Please note that this plasmid runs as a dimer (>7kb) or multimer. | Vector Backbone:pGWC; Vector Types:Plant Expression, CRISPR, PCR template; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:16:07 | 1 | |
|
pCBC-MT3T4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_50595 | T3, gRNA scaffold, U6-26t plus, OsU3p, T4 | Synthetic | Chloramphenicol | PMID:25432517 | Vector Backbone:pGWC; Vector Types:Plant Expression, CRISPR, PCR template; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:16:07 | 1 | ||
|
pCBC-DT1T2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_50590 | T1, U626t plus, U629p, T2 | Synthetic | Chloramphenicol | PMID:25432517 | Vector Backbone:pGWC; Vector Types:Plant Expression, CRISPR, PCR template; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:16:07 | 8 | ||
|
pCBC-DT3T4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_50592 | T3, gRNA scaffold, U6-1tplus, U6-26p, T4 | Synthetic | Chloramphenicol | PMID:25432517 | Vector Backbone:pGWC; Vector Types:Plant Expression, CRISPR, PCR template; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:16:07 | 3 | ||
|
pBS-3xGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_50659 | 3xGFP | Synthetic | Ampicillin | PMID:12566428 | Please note that this plasmid is unstable due to the tandem yeGFP genes. Screening of colonies is required prior to storage. See diagnostic digest for expected results. | Vector Backbone:pBS; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:10 | 1 | |
|
pCAG-rTetRDBD-GBP1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_50791 | rTetR DNA binding domain-GBP1 fusion protein | Synthetic | Ampicillin | PMID:23953120 | Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39. | Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:08 | 1 | |
|
pAcBac1.tR4-MbPyl Resource Report Resource Website 1+ mentions |
RRID:Addgene_50832 | two-copy Pyl tRNA cassette | Synthetic | Ampicillin | PMID:23818609 | Vector Backbone:pAcBac; Vector Types:Insect Expression, baculoviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:09 | 8 | ||
|
pCAG-GBP6-10gly-VPminx4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_50796 | GBP6-VPminx4 activation domain fusion protein | Synthetic | Ampicillin | PMID:23953120 | Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39. Note that GBP6 was verified in Addgene's quality control sequencing but cannot be displayed. | Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:11 | 1 | |
|
pAcBac2.tR4-OMeYRS/GFP* Resource Report Resource Website |
RRID:Addgene_50831 | two-copy Tyr tRNA cassette | Synthetic | Ampicillin | PMID:23818609 | Vector Backbone:pAcBac; Vector Types:Insect Expression, baculoviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:09 | 0 | ||
|
pCAG-EGxxFP Resource Report Resource Website 50+ mentions |
RRID:Addgene_50716 | split EGFP | Synthetic | Ampicillin | PMID:24284873 | Backbone Size:5138; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:08 | 63 | ||
|
RANLS-DEVD-BNES Resource Report Resource Website |
RRID:Addgene_50840 | ddRFP A and ddRFP B | Synthetic | Ampicillin | PMID:25622108 | There is a small discrepancy between the reference sequence and Addgene's quality control sequence, this causes an A to G mutation in the linker region between NLS and ddRFP B. This change should not affect plasmid function. | Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:09 | 0 | |
|
GANES-DEVD-BNLS Resource Report Resource Website 1+ mentions |
RRID:Addgene_50842 | ddGFP A and ddGFP B | Synthetic | Ampicillin | PMID:25622108 | Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:09 | 1 | ||
|
NESRA-DEVD-BNLS Resource Report Resource Website |
RRID:Addgene_50849 | ddRFP A and ddRFP B | Synthetic | Ampicillin | PMID:25622108 | Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:09 | 0 | ||
|
GANLS Resource Report Resource Website |
RRID:Addgene_50852 | ddGFP A | Synthetic | Ampicillin | PMID:25622108 | Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:09 | 0 | ||
|
pLKO.1-puro U6 sgRNA CAG Resource Report Resource Website 1+ mentions |
RRID:Addgene_50927 | negative control sgRNA | synthetic | Ampicillin | PMID:24346702 | Please note that Addgene's diagnostic digest results suggest that the backbone may be longer than suggested. | Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:13 | 4 | |
|
pSpCas9(BB)-2A-GFP (PX458) Resource Report Resource Website 1000+ mentions |
RRID:Addgene_48138 | hSpCas9 | Synthetic | Ampicillin | PMID:24157548 | For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/. | Vector Backbone:PX458; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:48 | 2375 | |
|
pAC152-dual-dCas9VP64-sgExpression Resource Report Resource Website 1+ mentions |
RRID:Addgene_48238 | dCas9 | Synthetic | Ampicillin | PMID:23979020 | Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT For more information including protocols and updates, please go to http://www.crispr-on.org | Vector Backbone:pX335 (Addgene #42335); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | D10A;H840A | 2026-08-15 01:15:48 | 3 |
|
pDONR P4-P1R-EYFP Resource Report Resource Website |
RRID:Addgene_48350 | EYFP | Synthetic | Kanamycin | PMID:23957834 | Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2655; Vector Backbone:pDONRP4-P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | Contains a Kozak sequence. Does not contain a stop codon. | 2026-08-15 01:15:49 | 0 | |
|
pDONR P4-P1R-EGFP Resource Report Resource Website |
RRID:Addgene_48348 | EGFP | Synthetic | Kanamycin | PMID:23957834 | Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2655; Vector Backbone:pDONRP4-P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | Contains a Kozak sequence. Does not contain a stop codon. Aminoacid 40 is valine in our sequence, while it is phenylalanine in other EGFP sequences. This does not seem to affect fluorescence. | 2026-08-15 01:15:49 | 0 | |
|
pDONR P2R-P3-mKate2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_48345 | mKate2 | Synthetic | Kanamycin | PMID:23957834 | Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2639; Vector Backbone:pDONRP2R-P3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | Contains a stop codon at the 3' end of the coding sequence. | 2026-08-15 01:15:49 | 3 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.