Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: PcaU(AM)-mRFP
Vector Backbone Description: Vector Backbone:Unspecified; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin
Defining Citation: PMID:34125913
Proper citation: RRID:Addgene_149484 Copy
Species: Synthetic
Genetic Insert: RhaS-RhaR-mRFP
Vector Backbone Description: Vector Backbone:Unspecified; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin
Defining Citation: PMID:34125913
Proper citation: RRID:Addgene_149486 Copy
Species: Synthetic
Genetic Insert: TtgR(AM)-mRFP
Vector Backbone Description: Vector Backbone:Unspecified; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin
Defining Citation: PMID:34125913
Proper citation: RRID:Addgene_149488 Copy
Species: Escherichia coli str. K-12 substr. MG1655; Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 nsp3
Vector Backbone Description: Backbone Size:1462; Vector Backbone:ori-013 - marker | cmR; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Comments: NCBI reference sequence: YP_009725299.1
Proper citation: RRID:Addgene_149524 Copy
Species: Escherichia coli str. K-12 substr. MG1655; Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 nsp3
Vector Backbone Description: Backbone Size:1462; Vector Backbone:ori-013 - marker | cmR; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Comments: NCBI reference sequence: YP_009725299.1
Proper citation: RRID:Addgene_149526 Copy
Species: Escherichia coli str. K-12 substr. MG1655; Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 M (membrane)
Vector Backbone Description: Backbone Size:3177; Vector Backbone:pG9m-2 lacIQ ampR; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009724393.1
Proper citation: RRID:Addgene_149529 Copy
Species: Escherichia coli str. K-12 substr. MG1655; Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 M (membrane)
Vector Backbone Description: Backbone Size:3177; Vector Backbone:pG9m-2 lacIQ ampR; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009724393.1
Proper citation: RRID:Addgene_149533 Copy
Species: Escherichia coli str. K-12 substr. MG1655; Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 S (surface glycoprotein)
Vector Backbone Description: Backbone Size:3177; Vector Backbone:pG9m-2 lacIQ ampR; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009724390.1
Proper citation: RRID:Addgene_149534 Copy
Species: Homo sapiens
Genetic Insert: SARS-CoV-2 S (surface glycoprotein)
Vector Backbone Description: Backbone Size:860; Vector Backbone:AmpR gene, with start and stop codons; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009724390.1 . This plasmid contains an 18 or 19bp truncation in the CMV promoter and was synthesized for making pseudotyped VSV particles. It has been shown that truncations either help expression and /or capture by VSVdeltaG. See https://www.ncbi.nlm.nih.gov/pubmed/19057867 for original paper on VSV pseudotyping, and https://www.cell.com/cell/pdf/S0092-8674(20)30229-4.pdf on more recent efforts with SARS-CoV-2.
Please note: Addgene NGS finds that the AmpR resistance marker is in the opposite orientation in the plasmid relative to the depositor's sequence. As the plasmid was able to grow in media with Ampicillin, this is not expected to affect plasmid function.
Proper citation: RRID:Addgene_149539 Copy
Species: Homo sapiens
Genetic Insert: SARS-CoV-2 S (surface glycoprotein)
Vector Backbone Description: Backbone Size:860; Vector Backbone:AmpR gene, with start and stop codons; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009724390.1 . This plasmid contains an 18 or 19bp truncation in the CMV promoter and was synthesized for making pseudotyped VSV particles. It has been shown that truncations either help expression and /or capture by VSVdeltaG. See https://www.ncbi.nlm.nih.gov/pubmed/19057867 for original paper on VSV pseudotyping, and https://www.cell.com/cell/pdf/S0092-8674(20)30229-4.pdf on more recent efforts with SARS-CoV-2.
Proper citation: RRID:Addgene_149542 Copy
Species: Homo sapiens
Genetic Insert: SARS-CoV-2 S (surface glycoprotein)
Vector Backbone Description: Backbone Size:860; Vector Backbone:AmpR gene, with start and stop codons; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009724390.1 . This plasmid contains an 18 or 19bp truncation in the CMV promoter and was synthesized for making pseudotyped VSV particles. It has been shown that truncations either help expression and /or capture by VSVdeltaG. See https://www.ncbi.nlm.nih.gov/pubmed/19057867 for original paper on VSV pseudotyping, and https://www.cell.com/cell/pdf/S0092-8674(20)30229-4.pdf on more recent efforts with SARS-CoV-2.
Please note: Addgene NGS finds that the AmpR resistance marker is in the opposite orientation in the plasmid relative to the depositor's sequence. As the plasmid was able to grow in media with Ampicillin, this is not expected to affect plasmid function.
Proper citation: RRID:Addgene_149543 Copy
Species: Rattus norvegicus
Genetic Insert: Glp1-R
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3?; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1326760
Proper citation: RRID:Addgene_14944 Copy
Species: Mus musculus
Genetic Insert: Tdg
Vector Backbone Description: Backbone Marker:Primo Schär Lab; Backbone Size:13769; Vector Backbone:pTCO2 (Addgene Plasmid #149428); Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33082936
Proper citation: RRID:Addgene_149430 Copy
Species: Synthetic
Genetic Insert: ERT2-Cre-ERT2 fusion protein
Vector Backbone Description: Backbone Marker:Primo Schär Lab; Backbone Size:4574; Vector Backbone:pBigTB (Addgene Plasmid #149432); Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33082936
Proper citation: RRID:Addgene_149433 Copy
Species: Synthetic
Genetic Insert: Flp-ERT2 fusion protein
Vector Backbone Description: Backbone Marker:Primo Schär Lab; Backbone Size:4573; Vector Backbone:pBigTB (Addgene Plasmid #149432); Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33082936
Proper citation: RRID:Addgene_149435 Copy
Species: Synthetic
Genetic Insert: ERT2-Cre-ERT2 fusion protein
Vector Backbone Description: Backbone Marker:Liqun Luo Lab (Addgene Plasmid #40026); Backbone Size:14483; Vector Backbone:pROSA26-TG; Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33082936
Proper citation: RRID:Addgene_149436 Copy
Species: Homo sapiens
Genetic Insert: Fcgamma RIIa
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5300; Vector Backbone:pIRESneo2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17110435
Comments: The FcgRIIa cDNA was amplified by RT-PCR using a Titan One Tube RT-PCR System kit (Roche, Mannheim, Germany) and a pair of primers (5'-TTGAATTCACCATGGAGACCCAAATGTCTC-3' and 5'-GCGGCCGCTTAGTTATTACTGTTGACATGG-3'). The PCR product was cloned into pCR2.1-TOPO (Invitrogen, Carlsbad, CA) to generate pAC01 and subcloned as an EcoRI–NotI fragment into pIRESneo2 (Clontech, Mountain View, CA) to generate pCMV-FcgRIIa-IRES-Neo.
Proper citation: RRID:Addgene_14948 Copy
Species: hamster
Genetic Insert: HMG CoA synthase promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5597; Vector Backbone:pGL2 basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16141315
Comments: To generate pHMGCS-Luc, a PCR fragment containing nucleotides –379 to –17 of the hamster 3-hydroxy-3-methylglutaryl (HMG) CoA synthase gene was cloned into pGL2-basic.
PCR'd using primers: CGATCTCCTCTCACTGACCTTC and GCAGCTTTATAGCCACCGACCC.
Proper citation: RRID:Addgene_14947 Copy
Vector Backbone Description: Backbone Size:4493; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See Fire Lab Vector Kit Documentation 1995. Fire Lab Miniprep Number pPD95.77, Ligation number NONE.
Proper citation: RRID:Addgene_1495 Copy
Species: Homo sapiens
Genetic Insert: Rheb1
Vector Backbone Description: Backbone Size:5300; Vector Backbone:HA-GST-pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17386266
Proper citation: RRID:Addgene_14951 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.