Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: LAP2
Vector Backbone Description: Backbone Marker:Available at Addgene (#1764); Backbone Size:5169; Vector Backbone:pBABE puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16959612
Comments: Human LAP2 was cloned by PCR from cDNA template and then digested with EcoR1/SalI and inserted in pBabe-Puro.
Proper citation: RRID:Addgene_15712 Copy
Species: Rattus norvegicus
Genetic Insert: mTOR
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12370290
Comments: See author's map for detailed information.
Proper citation: RRID:Addgene_15678 Copy
Species: Homo sapiens
Genetic Insert: p15 promoter
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pGL2-E1bTATA; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16959612
Comments: SBR2 is one of the Smad Binding Regions on the promoter
Proper citation: RRID:Addgene_15711 Copy
Species: Mus musculus
Genetic Insert: PRAS40 shRNA
Vector Backbone Description: Backbone Marker:Available at Addgene (#8453); Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17510057
Comments: Oligonucleotides encoding the short-hairpin RNA expression cassette targeting mouse PRAS40 from base 753-773 (GI:124376717) were annealed and subcloned into pLKO.1. See author's map for shRNA sequence information.
Proper citation: RRID:Addgene_15672 Copy
Vector Backbone Description: Backbone Size:8081; Vector Backbone:pCM433; Vector Types:bacterial allelic exchange vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:18710539
Comments: Ampicillin, Chloramphenicol, Tetracycline
Proper citation: RRID:Addgene_15670 Copy
Vector Backbone Description: Backbone Size:6921; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See Fire Lab Vector Kit Documentation 1997. Fire Lab Miniprep Number pPD115.107, Ligation number L3608.
Proper citation: RRID:Addgene_1573 Copy
Species: Homo sapiens
Genetic Insert: p15 4xSBR1
Vector Backbone Description: Backbone Size:5600; Vector Backbone:pGL2-E1bTATA; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16959612
Comments: SBR1 is one of the Smad Binding Regions on the p15INK4b promoter.
Smad binding element sequence - ACTAATTCGGGCAGAAAGACACATCCAAGAGAA
Proper citation: RRID:Addgene_15718 Copy
Species: Mus musculus
Genetic Insert: ERas
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pCAG-IH; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12774123
Proper citation: RRID:Addgene_15688 Copy
Species: Homo sapiens
Genetic Insert: TIF1 gamma shRNA
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pRetrosuper-GFP; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16751102
Comments: shRNA oligos were first cloned into pRetrosuper-Puro digested with BglII and HindIII.
Next, the AgeI/XhoI fragments from shRNA sequence-containing pRetrosuper-Puro plasmids were cloned into the AgeI/XhoI site of pRetrosuper-GFP.
Sense oligo: 5'-gatcccc GAAGATGTCT CAGAGTCTG ttcaagaga CAGACTCTGA GACATCTTC tttttggaaa-3'.
Proper citation: RRID:Addgene_15721 Copy
Species: Homo sapiens
Genetic Insert: YAP
Vector Backbone Description: Backbone Marker:Available at Addgene (#1764); Backbone Size:5169; Vector Backbone:pBABE puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16894141
Comments: The human YAP ORF was cloned into the pBABEpuro vector as an EcoRI–BamHI fragment. A single FLAG tag was added to the N terminus during PCR with the following primers: Hs.YAP.F, CCGGGATCCACCATGGATTACAAGGATGACGACGATAAGATGGACCCCGGGCAGCAGCCCGCCGC; and Hs.YAP.R, CCGGAATTCCTATAACCATGTAAGAAAGCTTTC.
Proper citation: RRID:Addgene_15682 Copy
Species: Rattus norvegicus
Genetic Insert: PHAS-I F113A
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4671; Vector Backbone:pET14b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12665511
Comments: Full-length PHASI with a His tag. See author's map for detailed information.
Proper citation: RRID:Addgene_15680 Copy
Species: Rattus norvegicus
Genetic Insert: rApoI
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:29991261
Comments: Esherichia coli strain that expresses rat APOBEC1. Genotype: DH10B Δung ΔmotAB ΔcsgABCDEFG [PlacI<>Ptac] Δ(araA-leu)7697::[PA1lacO-Tenth rApo1]
Proper citation: RRID:Addgene_156459 Copy
Species: Tn5
Genetic Insert: NeoR/KanR
Vector Backbone Description: Backbone Size:5863; Vector Backbone:BAC; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29991261
Comments: Please note that a low DNA yield is expected with single copy BACs. Using larger scale DNA preps (ie. midi preps) is recommended. If there are difficulties removing genomic DNA, the ExonucleaseV (recBCD) from NEB (M0345S) which degrades contaminating linear DNA can help improve results.
Proper citation: RRID:Addgene_156454 Copy
Vector Backbone Description: Backbone Size:6921; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See Fire Lab Vector Kit Documentation 1997. Fire Lab Miniprep Number pPD115.70, Ligation number L3574.
Proper citation: RRID:Addgene_1566 Copy
Species: Escherichia coli
Genetic Insert: rpsL
Vector Backbone Description: Backbone Size:4732; Vector Backbone:BAC; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29991261
Comments: Please note that a low DNA yield is expected with single copy BACs. Using larger scale DNA preps (ie. midi preps) is recommended. If there are difficulties removing genomic DNA, the ExonucleaseV (recBCD) from NEB (M0345S) which degrades contaminating linear DNA can help improve results.
Proper citation: RRID:Addgene_156455 Copy
Vector Backbone Description: Backbone Size:4816; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See Fire Lab Vector Kit Documentation 1997. Fire Lab Miniprep Number pPD115.99, Ligation number L3604.
Proper citation: RRID:Addgene_1569 Copy
Species: Homo sapiens
Genetic Insert: TIF1 gamma shRNA
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pRetrosuper; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16751102
Comments: shRNA oligos were cloned into pRetrosuper-Puro digested with BglII and HindIII.
Sense oligo: 5'-gatcccc GAAGATGTCT CAGAGTCTG ttcaagaga CAGACTCTGA GACATCTTC tttttggaaa-3'.
Proper citation: RRID:Addgene_15728 Copy
Species: Mus musculus
Genetic Insert: HybridJ-IRES-tauGFP LNL TV
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBS; Vector Types:high copy number; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15186781
Comments: The mouse strain that was derived from this plasmid is available from The Jackson Laboratory: http://jaxmice.jax.org/strain/006622.html
Proper citation: RRID:Addgene_15658 Copy
Species: Mus musculus
Genetic Insert: HybridH-IRES-tauGFP LNL TV
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBS; Vector Types:high copy number; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15186781
Comments: The mouse strain that was derived from this plasmid is available from The Jackson Laboratory: http://jaxmice.jax.org/strain/006624.html
Proper citation: RRID:Addgene_15656 Copy
Species: Mus musculus
Genetic Insert: HybridF-IRES-tauGFP LNL TV
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBS; Vector Types:high copy number; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15186781
Comments: The mouse strain that was derived from this plasmid is available from The Jackson Laboratory: http://jaxmice.jax.org/strain/006626.html
Proper citation: RRID:Addgene_15654 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
