Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 433 showing 8641 ~ 8660 out of 742,877 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_237358

    This resource has 1+ mentions.

http://www.addgene.org/237358

Species: RSV
Genetic Insert: RSV B F from 1992 human codon optimized from Genbank Accesion OK649748
Vector Backbone Description: Vector Backbone:HDM; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40607811
Comments: Please visit https://doi.org/10.1101/2025.03.11.642476 for bioRxiv preprint.

Proper citation: RRID:Addgene_237358 Copy   


  • RRID:Addgene_236546

http://www.addgene.org/236546

Species: Homo sapiens
Genetic Insert: Grx1-roGFP2-Coilin
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_236546 Copy   


  • RRID:Addgene_144855

http://www.addgene.org/144855

Species: Homo sapiens
Genetic Insert: ACTL6A
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_004301.4 Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.

Proper citation: RRID:Addgene_144855 Copy   


  • RRID:Addgene_142676

http://www.addgene.org/142676

Species: Homo sapiens
Genetic Insert: HNF4G
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_004133,ENST00000396423 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.

Proper citation: RRID:Addgene_142676 Copy   


  • RRID:Addgene_237222

http://www.addgene.org/237222

Species: Saccharomyces cerevisiae
Genetic Insert: Flpo recombinase
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38895464

Proper citation: RRID:Addgene_237222 Copy   


  • RRID:Addgene_143928

http://www.addgene.org/143928

Species: Homo sapiens
Genetic Insert: RCOR3
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_001136223,ENST00000419091 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.

Proper citation: RRID:Addgene_143928 Copy   


http://www.addgene.org/191217

Species: SARS CoV-2
Genetic Insert: SPIKE_SARS2_Alpha
Vector Backbone Description: Backbone Size:7737; Vector Backbone:pLD-puro-CcVA (Addgene plasmid #24588); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40593736

Proper citation: RRID:Addgene_191217 Copy   


  • RRID:Addgene_207605

http://www.addgene.org/207605

Species: Homo sapiens
Genetic Insert: GTTCTTCCATctgcaaaaaa
Vector Backbone Description: Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39578493

Proper citation: RRID:Addgene_207605 Copy   


  • RRID:Addgene_207606

http://www.addgene.org/207606

Species: Homo sapiens
Genetic Insert: TACTGGGTTCAGAAACAAGG
Vector Backbone Description: Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39578493

Proper citation: RRID:Addgene_207606 Copy   


  • RRID:Addgene_221072

http://www.addgene.org/221072

Species: Homo sapiens
Genetic Insert: Five repeats of E67R SUMO1 each separated by (GGS)4
Vector Backbone Description: Backbone Size:6600; Vector Backbone:pMAL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38262618

Proper citation: RRID:Addgene_221072 Copy   


  • RRID:Addgene_220268

http://www.addgene.org/220268

Species: Synthetic
Genetic Insert: LLhAraR
Vector Backbone Description: Backbone Marker:Jonathan Kuhn (Stewart et al. 1986 PMID: 3012611); Vector Backbone:pHG165a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_220268 Copy   


  • RRID:Addgene_220269

    This resource has 1+ mentions.

http://www.addgene.org/220269

Species: Synthetic
Genetic Insert: LLhKdgR
Vector Backbone Description: Backbone Marker:Jonathan Kuhn (Stewart et al. 1986 PMID: 3012611); Vector Backbone:pHG165a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_220269 Copy   


http://www.addgene.org/227451

Species: Mus musculus
Genetic Insert: CARGO to 2.1kb Upstream Prdm8
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660

Proper citation: RRID:Addgene_227451 Copy   


http://www.addgene.org/191219

Species: SARS CoV-2
Genetic Insert: SPIKE_SARS2_Delta
Vector Backbone Description: Backbone Size:7737; Vector Backbone:pLD-puro-CcVA (Addgene plasmid #24588); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40593736

Proper citation: RRID:Addgene_191219 Copy   


http://www.addgene.org/227452

Species: Mus musculus
Genetic Insert: CARGO to 700bp Upstream Prdm8
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660

Proper citation: RRID:Addgene_227452 Copy   


http://www.addgene.org/223654

Species: Homo sapiens
Genetic Insert: vTRAP-T2A-hM3D(Gq)
Vector Backbone Description: Backbone Size:4977; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40307547
Comments: Please visit https://doi.org/10.1101/2023.02.03.527010 for bioRxiv preprint.

Proper citation: RRID:Addgene_223654 Copy   


http://www.addgene.org/227454

Species: Mus musculus
Genetic Insert: CARGO to Prdm8 promoter Upstream Prdm8
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660

Proper citation: RRID:Addgene_227454 Copy   


http://www.addgene.org/227455

Species: Mus musculus
Genetic Insert: CARGO to Prdm8 promoter Upstream Prdm8
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660

Proper citation: RRID:Addgene_227455 Copy   


http://www.addgene.org/227456

Species: Mus musculus
Genetic Insert: CARGO to Prdm8 promoter Upstream Prdm8
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660

Proper citation: RRID:Addgene_227456 Copy   


http://www.addgene.org/227457

Species: Mus musculus
Genetic Insert: CARGO to 58kb Upstream Fgf5
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660

Proper citation: RRID:Addgene_227457 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X