Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

742,877 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
HDM_RSV_B_1992_F
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_237358 RSV B F from 1992 human codon optimized from Genbank Accesion OK649748 RSV Ampicillin PMID:40607811 Please visit https://doi.org/10.1101/2025.03.11.642476 for bioRxiv preprint. Vector Backbone:HDM; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:43:33 1
Grx1-roGFP2-Coilin
 
Resource Report
Resource Website 		RRID:Addgene_236546 Grx1-roGFP2-Coilin Homo sapiens Kanamycin Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-12 02:43:33 0
TFORF3379
 
Resource Report
Resource Website 		RRID:Addgene_144855 ACTL6A Homo sapiens Ampicillin PMID:36608654 NM_004301.4 Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence. Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-09-12 02:43:34 0
TFORF0690
 
Resource Report
Resource Website 		RRID:Addgene_142676 HNF4G Homo sapiens Ampicillin PMID:36608654 NM_004133,ENST00000396423 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence. Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-09-12 02:43:33 0
pAAV-Syn1-DIO-Flpo
 
Resource Report
Resource Website 		RRID:Addgene_237222 Flpo recombinase Saccharomyces cerevisiae Ampicillin PMID:38895464 Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin 2026-09-12 02:43:33 0
TFORF1113
 
Resource Report
Resource Website 		RRID:Addgene_143928 RCOR3 Homo sapiens Ampicillin PMID:36608654 NM_001136223,ENST00000419091 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence. Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-09-12 02:43:34 0
pLD-puro-Cc-SARS-CoV-2_Spike_Alpha-VA
 
Resource Report
Resource Website 		RRID:Addgene_191217 SPIKE_SARS2_Alpha SARS CoV-2 Ampicillin PMID:40593736 Backbone Size:7737; Vector Backbone:pLD-puro-CcVA (Addgene plasmid #24588); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Del 69-70 Del 144 N501Y A570D D614G P681H T716I S982A D1118H 2026-09-12 02:43:34 0
Halo XLF sgRNA
 
Resource Report
Resource Website 		RRID:Addgene_207605 GTTCTTCCATctgcaaaaaa Homo sapiens Ampicillin PMID:39578493 Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:43:34 0
HaloXRCC4 sgRNA
 
Resource Report
Resource Website 		RRID:Addgene_207606 TACTGGGTTCAGAAACAAGG Homo sapiens Ampicillin PMID:39578493 Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:43:34 0
poly E67R SUMO1
 
Resource Report
Resource Website 		RRID:Addgene_221072 Five repeats of E67R SUMO1 each separated by (GGS)4 Homo sapiens Ampicillin PMID:38262618 Backbone Size:6600; Vector Backbone:pMAL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin E67R 2026-09-12 02:43:35 0
LLhAraR-pHG165a
 
Resource Report
Resource Website 		RRID:Addgene_220268 LLhAraR Synthetic Ampicillin Backbone Marker:Jonathan Kuhn (Stewart et al. 1986 PMID: 3012611); Vector Backbone:pHG165a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:43:34 0
LLhKdgR-pHG165a
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_220269 LLhKdgR Synthetic Ampicillin Backbone Marker:Jonathan Kuhn (Stewart et al. 1986 PMID: 3012611); Vector Backbone:pHG165a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:43:34 1
pk335-CARGO-6mer-2.1kb-USP
 
Resource Report
Resource Website 		RRID:Addgene_227451 CARGO to 2.1kb Upstream Prdm8 Mus musculus Kanamycin PMID:39626660 Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-09-12 02:43:35 0
pLD-puro-Cc-SARS-CoV-2_Spike_Delta-VA
 
Resource Report
Resource Website 		RRID:Addgene_191219 SPIKE_SARS2_Delta SARS CoV-2 Ampicillin PMID:40593736 Backbone Size:7737; Vector Backbone:pLD-puro-CcVA (Addgene plasmid #24588); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin T19R 156del 157del R158G L452R T478K D614G P681R D950N 2026-09-12 02:43:34 0
pk335-CARGO-6mer-700bp-USP
 
Resource Report
Resource Website 		RRID:Addgene_227452 CARGO to 700bp Upstream Prdm8 Mus musculus Kanamycin PMID:39626660 Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-09-12 02:43:35 0
pAAV-hSyn-flx-fDIO-HA-Rpl10a-T2A-myc-hM3D(Gq)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_223654 vTRAP-T2A-hM3D(Gq) Homo sapiens Ampicillin PMID:40307547 Please visit https://doi.org/10.1101/2023.02.03.527010 for bioRxiv preprint. Backbone Size:4977; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-09-12 02:43:35 1
pk335-CARGO-5mer-PrPro
 
Resource Report
Resource Website 		RRID:Addgene_227454 CARGO to Prdm8 promoter Upstream Prdm8 Mus musculus Kanamycin PMID:39626660 Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-09-12 02:43:35 0
pk335-CARGO-4mer-PrPro
 
Resource Report
Resource Website 		RRID:Addgene_227455 CARGO to Prdm8 promoter Upstream Prdm8 Mus musculus Kanamycin PMID:39626660 Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-09-12 02:43:35 0
pk335-CARGO-3mer-PrPro
 
Resource Report
Resource Website 		RRID:Addgene_227456 CARGO to Prdm8 promoter Upstream Prdm8 Mus musculus Kanamycin PMID:39626660 Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-09-12 02:43:35 0
pk335-CARGO-6mer-58kb-USF
 
Resource Report
Resource Website 		RRID:Addgene_227457 CARGO to 58kb Upstream Fgf5 Mus musculus Kanamycin PMID:39626660 Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-09-12 02:43:35 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

NIDDK Early Research Partnership Engagement Challenge

Funding Opportunity: National NIH K12 DiabDocs Career Development Program

NIH Data Sharing and Reuse Seminar- Sex Differences in Acute Kidney Injury Risk and Outcomes: Insights from MIMIC-III and MIMIC-IV

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch