Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

744,118 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Authority

Sort Ascending

Sort Descending

 Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pJW1669
 
Resource Report
Resource Website 		RRID:Addgene_112043 NSG2 Saccharomyces cerevisiae Ampicillin PMID:29348368 Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-24 02:03:01 0
Hsh155 310-972
 
Resource Report
Resource Website 		RRID:Addgene_111994 Hsh155 310-972 Saccharomyces cerevisiae Ampicillin PMID:29752352 Backbone Marker:ATCC; Backbone Size:5208; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin 310-972 truncation Addgene 2026-10-24 02:03:00 0
pJW1672
 
Resource Report
Resource Website 		RRID:Addgene_112046 PST1 Saccharomyces cerevisiae Ampicillin PMID:29348368 Please note that Addgene NGS results identified an ambiguous base (A/C) at position 2762, in yEGFP. Ura marker present. This could result in a G67C mutation in yEGFP, though this is not expected to affect plasmid function. Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-24 02:03:01 0
Hsh155 237-972
 
Resource Report
Resource Website 		RRID:Addgene_111992 Hsh155 237-972 Saccharomyces cerevisiae Ampicillin PMID:29752352 Backbone Marker:ATCC; Backbone Size:5208; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin 237-972 truncation Addgene 2026-10-24 02:03:00 0
Hsh155 472-972
 
Resource Report
Resource Website 		RRID:Addgene_111996 Hsh155 472-972 Saccharomyces cerevisiae Ampicillin PMID:29752352 Backbone Marker:ATCC; Backbone Size:5208; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin 472-972 truncation Addgene 2026-10-24 02:03:00 0
pNAS1b split mCherry NEDD4 WW2 neg ctrl
 
Resource Report
Resource Website 		RRID:Addgene_112030 NEDD4 WW2 domain fused to C-terminal split mCherry, neg ctrl interacting peptide fused to N-terminal split mCherry Ampicillin PMID:29889213 Backbone originally described in Sawyer, et al, Designed Phosphoprotein Recognition in Escherichia coli, 2014. Binding domain under araBAD, phosphosite/peptide cassette under pLtetO Backbone Size:5500; Vector Backbone:pNAS1b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-24 02:03:01 0
pJW1660
 
Resource Report
Resource Website 		RRID:Addgene_112034 IAA17 Arabidopsis thaliana Ampicillin PMID:29348368 Vector Backbone:pRS305; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin only amino acids 71-114 Addgene 2026-10-24 02:03:01 0
pNAS1b split mCherry 14-3-3β ctrl
 
Resource Report
Resource Website 		RRID:Addgene_112031 14-3-3β fused to C-terminal split mCherry, phospho-dependent binding ctrl peptide with TAG fused to N-terminal split mCherry Ampicillin PMID:29889213 Backbone originally described in Sawyer, et al, Designed Phosphoprotein Recognition in Escherichia coli, 2014. Binding domain under araBAD, phosphosite/peptide cassette under pLtetO Backbone Size:5500; Vector Backbone:pNAS1b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-24 02:03:01 0
pJW1663
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_112037 Gal DNA binding-estradiol binding-MSN2 activator Ampicillin PMID:29348368 Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-24 02:03:01 3
pJW1664
 
Resource Report
Resource Website 		RRID:Addgene_112038 Su9 Saccharomyces cerevisiae Ampicillin PMID:29348368 Vector Backbone:pRS313; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin amino acids 1-76 Addgene 2026-10-24 02:03:01 0
pJW1661
 
Resource Report
Resource Website 		RRID:Addgene_112035 TIR1 Oryza sativa Ampicillin PMID:29348368 Vector Backbone:pRS306; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-24 02:03:01 0
pACY.HR4_T7_term_HRR
 
Resource Report
Resource Website 		RRID:Addgene_111986 Chloramphenicol PMID:29724956 Backbone Size:2787; Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol Addgene 2026-10-24 02:03:00 0
Hsh155 96-972
 
Resource Report
Resource Website 		RRID:Addgene_111988 Hsh155 96-972 Saccharomyces cerevisiae Ampicillin PMID:29752352 Backbone Marker:ATCC; Backbone Size:5208; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin 96-972 truncation Addgene 2026-10-24 02:03:00 0
Hsh155 103-972
 
Resource Report
Resource Website 		RRID:Addgene_111989 Hsh155 103-972 Saccharomyces cerevisiae Ampicillin PMID:29752352 Backbone Marker:ATCC; Backbone Size:5208; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin 103-972 truncation Addgene 2026-10-24 02:03:00 0
fSAP24-GST
 
Resource Report
Resource Website 		RRID:Addgene_11202 SAP24 Homo sapiens Ampicillin PMID:15998806 Reed lab clone #783. Backbone Marker:Amersham; Backbone Size:0; Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-24 02:03:01 0
hPrp16 N-terminus
 
Resource Report
Resource Website 		RRID:Addgene_11204 Prp16 N-terminus Homo sapiens Ampicillin PMID:9524131 Reed lab clone #354. Backbone Marker:Pharmacia; Backbone Size:4970; Vector Backbone:pGEX2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Amino acids 1-554 Addgene 2026-10-24 02:03:01 0
NYESO alpha into TRAC HDRT Source (pTR 223)
 
Resource Report
Resource Website 		RRID:Addgene_112023 NYESO alpha into TRAC HDRT Homo sapiens Ampicillin PMID:29995861 gRNA sequence that can be used with this DNA template: AGAGTCTCTCAGCTGGTACA Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin Addgene 2026-10-24 02:03:01 0
NYESO beta/alpha into TRAC HDRT Source (pTR 169)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_112021 NYESO beta/alpha into TRAC HDRT Homo sapiens Ampicillin PMID:29995861 gRNA sequence that can be used with this DNA template: AGAGTCTCTCAGCTGGTACA Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin Addgene 2026-10-24 02:03:01 1
Hsh155 Hs 5-20 3xFLAG
 
Resource Report
Resource Website 		RRID:Addgene_111971 Hsh155 Hs 5-20 3x FLAG Saccharomyces cerevisiae Ampicillin PMID:29752352 Backbone Marker:ATCC; Backbone Size:5208; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin Human HEATs 5-20 inserted Addgene 2026-10-24 02:03:00 0
pBC2T-LC3B
 
Resource Report
Resource Website 		RRID:Addgene_112026 LC3B Homo sapiens Kanamycin PMID:29500346 Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Addgene 2026-10-24 02:03:01 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join the NIDDK-CR Webinar "Pixels to Phenotypes – Whole Slide Imaging Pathomics” on October 28, 2026

dkNET Webinar: Gene Regulatory Network Analysis in Texera

dkNET Webinar: A Hormone Cell Atlas Maps the Human Endocrine System at Cellular Resolution

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch