Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 428 showing 8541 ~ 8560 out of 742,877 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/227454

Species: Mus musculus
Genetic Insert: CARGO to Prdm8 promoter Upstream Prdm8
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660

Proper citation: RRID:Addgene_227454 Copy   


http://www.addgene.org/227455

Species: Mus musculus
Genetic Insert: CARGO to Prdm8 promoter Upstream Prdm8
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660

Proper citation: RRID:Addgene_227455 Copy   


http://www.addgene.org/227456

Species: Mus musculus
Genetic Insert: CARGO to Prdm8 promoter Upstream Prdm8
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660

Proper citation: RRID:Addgene_227456 Copy   


http://www.addgene.org/227457

Species: Mus musculus
Genetic Insert: CARGO to 58kb Upstream Fgf5
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660

Proper citation: RRID:Addgene_227457 Copy   


http://www.addgene.org/227460

Species: Mus musculus
Genetic Insert: CARGO to 40kb Upstream Fgf5
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660

Proper citation: RRID:Addgene_227460 Copy   


http://www.addgene.org/191224

Species: Homo sapiens
Genetic Insert: interferon-induced protein with tetratricopeptide repeats 5
Vector Backbone Description: Backbone Size:7737; Vector Backbone:pLD-puro-CcVA (Addgene plasmid #24588); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40593736
Comments: Addgene's NGS results found a 51 bp insertion in the IFIT5 insert ORF that does not affect plasmid function.

Proper citation: RRID:Addgene_191224 Copy   


http://www.addgene.org/191221

Species: Homo sapiens
Genetic Insert: interferon-induced protein with tetratricopeptide repeats 5
Vector Backbone Description: Backbone Size:7737; Vector Backbone:pLD-puro-CcVA (Addgene plasmid #24588); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40593736

Proper citation: RRID:Addgene_191221 Copy   


http://www.addgene.org/227445

Species: Mus musculus
Genetic Insert: CARGO to 24kb Upstream Prdm8
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660

Proper citation: RRID:Addgene_227445 Copy   


http://www.addgene.org/227446

Species: Mus musculus
Genetic Insert: CARGO to 20kb Upstream Prdm8
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660

Proper citation: RRID:Addgene_227446 Copy   


  • RRID:Addgene_207583

http://www.addgene.org/207583

Species: Homo sapiens
Genetic Insert: GAGCAGTAGCCAACATGTCA
Vector Backbone Description: Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39578493

Proper citation: RRID:Addgene_207583 Copy   


http://www.addgene.org/214429

Species: Other
Genetic Insert: SARS-CoV-2 NSP3 (part of SARS-CoV-2 ORF1ab)
Vector Backbone Description: Backbone Marker:David Root lab; Backbone Size:10065; Vector Backbone:pLEX_307; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40593736

Proper citation: RRID:Addgene_214429 Copy   


http://www.addgene.org/191220

Species: SARS CoV-2
Genetic Insert: SPIKE_SARS2_Lambda
Vector Backbone Description: Backbone Size:7737; Vector Backbone:pLD-puro-CcVA (Addgene plasmid #24588); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40593736

Proper citation: RRID:Addgene_191220 Copy   


http://www.addgene.org/207100

Species: Homo sapiens
Genetic Insert: GAGATGCACAAAGTAAGGCC
Vector Backbone Description: Backbone Size:8484; Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37341699

Proper citation: RRID:Addgene_207100 Copy   


http://www.addgene.org/227475

Species: Mus musculus
Genetic Insert: CARGO to 3.3kb Upstream Fgf5
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660

Proper citation: RRID:Addgene_227475 Copy   


http://www.addgene.org/227476

Species: Mus musculus
Genetic Insert: CARGO to 1.9kb Upstream Fgf5
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660

Proper citation: RRID:Addgene_227476 Copy   


http://www.addgene.org/227477

Species: Mus musculus
Genetic Insert: CARGO to 2.4kb Upstream Fgf5
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660

Proper citation: RRID:Addgene_227477 Copy   


  • RRID:Addgene_211562

http://www.addgene.org/211562

Species: Synthetic
Genetic Insert: tRNAHis
Vector Backbone Description: Vector Backbone:pUC57; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Cloned using pAla57 as the vector

Proper citation: RRID:Addgene_211562 Copy   


  • RRID:Addgene_211561

http://www.addgene.org/211561

Species: Synthetic
Genetic Insert: tRNAGly
Vector Backbone Description: Vector Backbone:pUC57; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Cloned using pAla57 as the vector

Proper citation: RRID:Addgene_211561 Copy   


http://www.addgene.org/227480

Species: Mus musculus
Genetic Insert: CARGO to Fgf5 promoter
Vector Backbone Description: Vector Backbone:pk335-BFP; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39626660

Proper citation: RRID:Addgene_227480 Copy   


  • RRID:Addgene_211569

http://www.addgene.org/211569

Species: Synthetic
Genetic Insert: tRNAPro
Vector Backbone Description: Vector Backbone:pUC57; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Cloned using pAla57 as the vector

Proper citation: RRID:Addgene_211569 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X