Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pT7-EGFP-C1-HsDCP1a-S12AQ18AH19A_V Resource Report Resource Website |
RRID:Addgene_147805 | HsDCP1a-S12AQ18AH19A | Homo sapiens | Kanamycin | PMID:24510189 | Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. | Vector Backbone:Unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | two silent mutations T237C and T1716G compared to the sequence given by NCBI AY146651.1. | 2026-09-19 02:10:39 | 0 |
|
pRD182 (Roc1b) Resource Report Resource Website |
RRID:Addgene_14823 | Roc1b | Drosophila melanogaster | Ampicillin | Backbone Marker:Promega; Backbone Size:2600; Vector Backbone:T7 IVT; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:10:40 | 0 | |||
|
pRD183 (Roc2) Resource Report Resource Website |
RRID:Addgene_14824 | Roc2 | Drosophila melanogaster | Ampicillin | Backbone Marker:Promega; Backbone Size:2600; Vector Backbone:T7 IVT; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:10:40 | 0 | |||
|
pnYC-NpM-HsNot1iso1_1356-1581_V Resource Report Resource Website |
RRID:Addgene_147779 | HsNot1iso1_1356-1581 | Homo sapiens | Chloramphenicol | PMID:24768540 | Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. | Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | 2026-09-19 02:10:39 | 0 | |
|
pcDNA3.1 Hmga2 wt Resource Report Resource Website 1+ mentions |
RRID:Addgene_14789 | Hmga2 wt | Mus musculus | Ampicillin | PMID:17322030 | The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). The UTR fragment was then cloned back into the vector containing the Hmga2 cDNA (pCMV•SPORT6.1). To construct the mammalian expression vectors, Hmga2 inserts were excised from the pCMV•SPORT6.1 constructs using EcoRI restriction sites and cloned into pcDNA3.1 (Invitrogen). | Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:10:40 | 3 | |
|
pRD119 (PCNA GFP) Resource Report Resource Website |
RRID:Addgene_14822 | PCNA-GFP | Drosophila melanogaster | Ampicillin | PMID:12526745 | PCNA GFP fusion (glow); Asp718-NotI fragment from pRD113 cloned into pCasper4IN; GFP fused in-frame using 5' blunt NheI and 3' XbaI (replaces PCNA coding to STOP [XbaI] but has PCNA 3'; GFP from pNEGFPX.1. | Backbone Marker:na; Backbone Size:0; Vector Backbone:na; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:10:40 | 0 | |
|
pRD60 (dE2F) Resource Report Resource Website |
RRID:Addgene_14820 | E2F | Drosophila melanogaster | Ampicillin | Dros14 dE2F clone flipped at EcoRI site; XhoI digestion gives small fragment--i.e. 5' end near KpnI site; contains entire 3' UTR from Genebank sequence including polyA. | Backbone Marker:na; Backbone Size:0; Vector Backbone:na; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:10:40 | 0 | ||
|
pAc5.1B-lambdaN-HA-DmSKI8_AA Resource Report Resource Website |
RRID:Addgene_148227 | DmSKI8 | Drosophila melanogaster | Ampicillin | sequence given by NCBI:NM_141712.3 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. | Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:10:40 | 0 | ||
|
MSCV let-7g Resource Report Resource Website 1+ mentions |
RRID:Addgene_14784 | let-7g | Mus musculus | Ampicillin | PMID:17401365 | miRNA of the following mature sequence, with approximately 500 basepairs of flanking sequence, were cloned into MSCV-neo: let-7g: 5’-UGAGG UAGUA GUUUG UACAG U-3’. | Backbone Marker:BD Biosciences; Backbone Size:6500; Vector Backbone:MSCV-neo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-09-19 02:10:40 | 1 | |
|
Hmga2 3'UTR wt luciferase (Luc-wt) Resource Report Resource Website 1+ mentions |
RRID:Addgene_14785 | Luc-wt | Mus musculus | Ampicillin | PMID:17322030 | The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). To construct the Renilla luciferase reporters, wild-type and mutant Hmga2 3' UTRs were amplified (PCR primers, 5'-GCGTCTCGAGGGGCGCCGACATTC and 5'GGCGCGGCCGCAGTCAGAGGGCACAC) and cloned into the XbaI and NotI sites of pIS1. | Backbone Marker:Available from Addgene (#12179); Backbone Size:4000; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-09-19 02:10:40 | 8 | |
|
pnYC-NpM-NcPAN2_1-390_Y Resource Report Resource Website |
RRID:Addgene_148103 | NcPAN2_1-390 | Neurospora crassa | Chloramphenicol | PMID:24880343 | ORF extracted from N. crassa Databank NCU10733.7 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. | Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | 2026-09-19 02:10:40 | 0 | |
|
pSuper mouse Drosha1 Resource Report Resource Website |
RRID:Addgene_14780 | Drosha shRNA | Mus musculus | Ampicillin | PMID:17401365 | shRNA sequence: GATCCCCCAA CAGTCATAGA ATATGATTCA AGAGATCATA TTCTATGACT GTTGTTTTTG GAAC | Backbone Marker:OligoEngine; Backbone Size:6350; Vector Backbone:pSUPER.retro.puro; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin | 2026-09-19 02:10:39 | 0 | |
|
pSicoR mouse Dicer3 Resource Report Resource Website |
RRID:Addgene_14781 | Dicer shRNA | Mus musculus | Ampicillin | PMID:17401365 | shRNA sequence: TGCATGGTGG TGTCGATATT TTCAAGAGAA ATATCGACAC CACCATGCTT TTTTC | Backbone Size:7700; Vector Backbone:pSicoR PGK puro; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-09-19 02:10:39 | 0 | |
|
pT7-EGFP-C1-HsNot1iso1_1-1840-shRNAres_W Resource Report Resource Website |
RRID:Addgene_147891 | HsNot1iso1_1-1840-shRNAres | Homo sapiens | Kanamycin | PMID:24768540 | Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. | Vector Backbone:Unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 1 silent mutation compared to the sequence of isoform 1 given by NCBI: NM_016284.4. | 2026-09-19 02:10:40 | 0 |
|
pcDNA3.1-MS2-HA-HsSmg5-G120E_W Resource Report Resource Website |
RRID:Addgene_147819 | HsSmg5-G120E | Homo sapiens | Ampicillin | PMID:24115769 | Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. | Vector Backbone:Unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | one silent mutation compared to the sequence given by NCBI: NM_015327.2. | 2026-09-19 02:10:39 | 0 |
|
pRK Smad3NL Flag Resource Report Resource Website 1+ mentions |
RRID:Addgene_14828 | Smad3 NL | Homo sapiens | Ampicillin | PMID:9094310 | See Author's map for cloning details. | Backbone Marker:Genentech; Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | amino acids 1-210 | 2026-09-19 02:10:40 | 1 |
|
pcDNA3.1-MS2-HA-HsNanos3-del4-20_X Resource Report Resource Website |
RRID:Addgene_147945 | HsNanos3-del4-20 | Homo sapiens | Ampicillin | PMID:24736845 | synthesized DNA from GeneArt. Codon optimized for Expression in human cells. Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. | Vector Backbone:Unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:10:40 | 0 | |
|
pcDNA3/HA-RBP2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_14799 | Retinoblastoma Binding Protein 2 | Homo sapiens | Ampicillin | PMID:17320163 | The plasmid encodes isoform 2. | Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:10:40 | 3 | |
|
pRK Smad3C Flag Resource Report Resource Website 1+ mentions |
RRID:Addgene_14830 | Smad3 C | Homo sapiens | Ampicillin | PMID:9094310 | See Author's map for cloning details. | Backbone Marker:Genentech; Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | amino acids 199-424 | 2026-09-19 02:10:40 | 1 |
|
pRK5 TGF beta type I receptor Flag Resource Report Resource Website 1+ mentions |
RRID:Addgene_14831 | TGF beta type I receptor | Rattus norvegicus | Ampicillin | PMID:8662796 | See Author's map for more information. A 9bp linker was added directly upstream of the GS domain. The linker encodes the amino acids GSM. The additional sequence does not affect plasmid function. | Backbone Marker:Genentech; Backbone Size:4700; Vector Backbone:pRK5 modified with flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:10:41 | 4 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
