Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: mEGFP
Vector Backbone Description: Vector Backbone:pCru5; Vector Types:Mammalian Expression, Retroviral, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23798422
Comments: Vector allows for control of transgene expression at the level of translation. It is 1 vector in a set of 9 that spans a range of expression levels. Sequencing through any part of the IRES sequence is not advised. Expression of gene downstream of IRES remains constant, despite varying expression of gene upstream.
Proper citation: RRID:Addgene_49226 Copy
Species: Synthetic
Genetic Insert: mEGFP
Vector Backbone Description: Vector Backbone:pCru5; Vector Types:Mammalian Expression, Retroviral, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23798422
Comments: Vector allows for control of transgene expression at the level of translation. It is 1 vector in a set of 9 that spans a range of expression levels. Sequencing through any part of the IRES sequence is not advised. Expression of gene downstream of IRES remains constant, despite varying expression of gene upstream.
Proper citation: RRID:Addgene_49220 Copy
Species: Synthetic
Genetic Insert: mEGFP
Vector Backbone Description: Vector Backbone:pCru5; Vector Types:Mammalian Expression, Retroviral, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23798422
Comments: Vector allows for control of transgene expression at the level of translation. It is 1 vector in a set of 9 that spans a range of expression levels. Sequencing through any part of the IRES sequence is not advised. Expression of gene downstream of IRES remains constant, despite varying expression of gene upstream.
Proper citation: RRID:Addgene_49222 Copy
Species: Synthetic
Genetic Insert: FRT forward
Vector Backbone Description: Backbone Marker:Stratagene; Vector Backbone:pBluescript; Vector Types:cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24116091
Proper citation: RRID:Addgene_49310 Copy
Species: Synthetic
Genetic Insert: luc2
Vector Backbone Description: Backbone Marker:Genscript; Backbone Size:2693; Vector Backbone:pUC57; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25177895
Proper citation: RRID:Addgene_49352 Copy
Species: Synthetic
Genetic Insert: luc2
Vector Backbone Description: Backbone Marker:Genscript; Backbone Size:2693; Vector Backbone:pUC57; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25177895
Proper citation: RRID:Addgene_49353 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Dr. James Sutherland ; Backbone Size:6600; Vector Backbone:pAc-STABLE1-Puro; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24326186
Comments: gRNA target sequence GGTTTTGGACACTGGAACCG
Proper citation: RRID:Addgene_49331 Copy
Species: Synthetic
Genetic Insert: GBP7-p65 transactivation domain fusion protein
Vector Backbone Description: Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23953120
Comments: Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138.
Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.
Proper citation: RRID:Addgene_49441 Copy
Species: Synthetic
Genetic Insert: GPD-roGFP2
Vector Backbone Description: Backbone Marker:ViraQuest Inc.; Backbone Size:5217; Vector Backbone:VQ Ad5CMV K-NpA; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20019331
Proper citation: RRID:Addgene_49436 Copy
Species: Synthetic
Genetic Insert: roGFP2
Vector Backbone Description: Backbone Marker:ViraQuest Inc.; Backbone Size:5217; Vector Backbone:VQ Ad5CMV K-NpA; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20019331
Proper citation: RRID:Addgene_49435 Copy
Species: Synthetic
Genetic Insert: GBP2-Gal4 DNA binding domain fusion protein
Vector Backbone Description: Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23953120
Comments: Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138.
Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.
Proper citation: RRID:Addgene_49439 Copy
Species: Synthetic
Genetic Insert: GBP1-Gal4 DNA binding domain fusion protein
Vector Backbone Description: Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23953120
Comments: The GBP1 used differs from the PDB GBP1 by two amino acids. One is Q3D at a site away from the GFP binding pocket and not expected to affect GFP binding. The second was a C98S mutation to enhance protein solubility.
Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138.
Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.
Proper citation: RRID:Addgene_49438 Copy
Species: Synthetic
Genetic Insert: TelR15
Vector Backbone Description: Backbone Marker:Pierce; Backbone Size:3600; Vector Backbone:pT7CFE1; Vector Types:In vitro Translation; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24324157
Proper citation: RRID:Addgene_49646 Copy
Species: Synthetic
Genetic Insert: TelR15
Vector Backbone Description: Backbone Marker:Pierce; Backbone Size:3600; Vector Backbone:pT7CFE1; Vector Types:In vitro Translation; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24324157
Proper citation: RRID:Addgene_49645 Copy
Species: Synthetic
Genetic Insert: TelR15
Vector Backbone Description: Backbone Marker:Pierce; Backbone Size:3600; Vector Backbone:pT7CFE1; Vector Types:In vitro Translation; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24324157
Proper citation: RRID:Addgene_49643 Copy
Species: Synthetic
Genetic Insert: TelR15
Vector Backbone Description: Backbone Marker:Pierce; Backbone Size:3600; Vector Backbone:pT7CFE1; Vector Types:In vitro Translation; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24324157
Proper citation: RRID:Addgene_49647 Copy
Species: Synthetic
Genetic Insert: sfgfp
Vector Backbone Description: Vector Backbone:pVRb; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24169405
Proper citation: RRID:Addgene_49712 Copy
Species: Synthetic
Genetic Insert: sfgfp
Vector Backbone Description: Vector Backbone:pVRb; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24169405
Proper citation: RRID:Addgene_49711 Copy
Species: Synthetic
Genetic Insert: sfgfp
Vector Backbone Description: Vector Backbone:pVRb; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24169405
Proper citation: RRID:Addgene_49710 Copy
Species: Synthetic
Genetic Insert: sfgfp
Vector Backbone Description: Vector Backbone:pVRb; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24169405
Proper citation: RRID:Addgene_49713 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.