Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
|||||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
PB-U6insert Resource Report Resource Website 1+ mentions |
RRID:Addgene_104536 | Ampicillin | PMID:30093604 | Backbone Marker:Systems Biosciences; Backbone Size:4700; Vector Backbone:Piggybac; Vector Types:Mammalian Expression, Mouse Targeting, CRISPR, Synthetic Biology, Piggybac transposon; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 01:56:37 | 5 | ||||
|
pILGFP4M Resource Report Resource Website |
RRID:Addgene_104508 | SeGAL2 promoter-yEGFP | Saccharomyces eubayanus | Ampicillin | PMID:29301066 | Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 01:56:37 | 0 | ||
|
pG-HIV-2LTR Resource Report Resource Website 1+ mentions |
RRID:Addgene_104590 | 2LTR circle junction of HIV-1 | HIV-1 virus | Ampicillin | PMID:18762215 | During HIV-1 infection, unintegrated viral cDNA may be circularized. The circularization generates a unique junction between the long terminal repeat (LTR) ends. HIV-1 2LTR circles have been quantified as measure of viral replication or entry of the viral cDNA into the host cell nucleus. The amplicon is 2672-2879 in the Addgene sequence file. This corresponds to HIV-1 strain HXB2 reference genome 9585-9719 bp (Addgene 2672-2806 bp) fused to 1 to 51 bp (Addgene 2829-2879 bp). In this plasmid there are 22 bp (Addgene 2807-2828 bp) of random sequence inserted between the HIV-1 ends. The insert may be amplified with primers MH535 (5' AACTAGGGAACCCACTGCTTAAG), MH536 (5' TCCACAGATCAAGGATATCTTGTC), and Taqman probe MH603 (5' ACACTACTTGAAGCACTCAAGGCAAGCTTT). | Backbone Marker:Promega; Backbone Size:3001; Vector Backbone:pGemT; Vector Types:cloning vector; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 01:56:38 | 1 | |
|
pRVL-3 Resource Report Resource Website |
RRID:Addgene_104581 | Mouse IgG2c CH1/CH2/CH3 (mutated, no effector functions) | Mus musculus | Ampicillin | PMID:30196504 | Backbone Marker:Invitrogen (Thermo Fisher); Backbone Size:10143; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | L234A/L235E/G237A and E318A/K320A/K322A | Addgene | 2026-10-31 01:56:38 | 0 | |
|
pRVL-5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_104583 | Human IgG1 CH1/CH2/CH3 | Homo sapiens | Ampicillin | PMID:30196504 | Addgene NGS results found A169G, A261G, A292G, and A295G within the EBNA1 translation on the pCEP4 backbone compared to YP_401677.1 | Backbone Marker:Invitrogen (Thermo Fisher); Backbone Size:10143; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 01:56:38 | 2 | |
|
pILGFP4I Resource Report Resource Website |
RRID:Addgene_104504 | SkGAL1 promoter-yEGFP | Saccharomyces kudriavzevii | Ampicillin | PMID:29301066 | Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 01:56:37 | 0 | ||
|
pILGFP4L Resource Report Resource Website |
RRID:Addgene_104507 | SmGAL2 promoter-yEGFP | Saccharomyces mikatae | Ampicillin | PMID:29301066 | Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 01:56:37 | 0 | ||
|
pILGFP4K Resource Report Resource Website |
RRID:Addgene_104506 | SpGAL1 promoter-yEGFP | Saccharomyces paradoxus | Ampicillin | PMID:29301066 | Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 01:56:37 | 0 | ||
|
Twitch-2C pcDNA3 Resource Report Resource Website |
RRID:Addgene_104501 | Twitch-2C | Aequoria Victoria, Opsanus | Ampicillin | PMID:24390440 | Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pSETB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 01:56:37 | 0 | ||
|
pAAV-HDR-mEGFP-camk2a Resource Report Resource Website 1+ mentions |
RRID:Addgene_104589 | calcium/calmodulin-dependent protein kinase II alpha | Mus musculus | Ampicillin | PMID:29056297 | Backbone Size:2905; Vector Backbone:PX551; Vector Types:Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 01:56:38 | 3 | ||
|
pAAV-EFS-SpCas9 Resource Report Resource Website 1+ mentions |
RRID:Addgene_104588 | Streptococcus pyogenes Cas9 | Synthetic | Ampicillin | PMID:29056297 | Backbone Marker:Addgene #60957; Backbone Size:2905; Vector Backbone:PX551; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 01:56:38 | 9 | ||
|
LI A-B pGala7 Resource Report Resource Website |
RRID:Addgene_104516 | Gala7 promoter | Gentamicin | PMID:29077245 | Backbone Marker:Parniske lab; Backbone Size:2458; Vector Backbone:pUC57; Vector Types:Cloning vector; Bacterial Resistance:Gentamicin | Addgene | 2026-10-31 01:56:37 | 0 | |||
|
LI C-D Dest Resource Report Resource Website |
RRID:Addgene_104518 | Gateway cassette | Chloramphenicol and Gentamicin | PMID:29077245 | Backbone Marker:Parniske lab; Backbone Size:2458; Vector Backbone:pUC57; Vector Types:Cloning vector; Bacterial Resistance:Chloramphenicol and Gentamicin | Addgene | 2026-10-31 01:56:37 | 0 | |||
|
LI A-B phrpB Resource Report Resource Website |
RRID:Addgene_104514 | hrpB promoter | Gentamicin | PMID:29077245 | Backbone Marker:Parniske lab; Backbone Size:2458; Vector Backbone:pUC57; Vector Types:Cloning vector; Bacterial Resistance:Gentamicin | Addgene | 2026-10-31 01:56:37 | 0 | |||
|
pILGFP4R Resource Report Resource Website |
RRID:Addgene_104513 | SuGAL2 promoter-yEGFP | Saccharomyces uvarum | Ampicillin | PMID:29301066 | Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 01:56:37 | 0 | ||
|
pUG-UBC19 Resource Report Resource Website |
RRID:Addgene_104684 | AtUBC19 | Arabidopsis thaliana | Spectinomycin | PMID:29194629 | release insert with BsaI and clone to Level 1 cloning vector | Backbone Marker:self-made; Backbone Size:2251; Vector Backbone:pICH41308; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin | BpiI/BsaI sites removed by point-mutation | Addgene | 2026-10-31 01:56:38 | 0 |
|
pUG-UBC15 Resource Report Resource Website |
RRID:Addgene_104680 | AtUBC15 | Arabidopsis thaliana | Spectinomycin | PMID:29194629 | release insert with BsaI and clone to Level 1 cloning vector | Backbone Marker:self-made; Backbone Size:2251; Vector Backbone:pICH41308; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin | BpiI/BsaI sites removed by point-mutation | Addgene | 2026-10-31 01:56:38 | 0 |
|
pUG-UBC16 Resource Report Resource Website |
RRID:Addgene_104681 | AtUBC16 | Arabidopsis thaliana | Spectinomycin | PMID:29194629 | release insert with BsaI and clone to Level 1 cloning vector | Backbone Marker:self-made; Backbone Size:2251; Vector Backbone:pICH41308; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin | BpiI/BsaI sites removed by point-mutation | Addgene | 2026-10-31 01:56:38 | 0 |
|
pUG-UBC23 Resource Report Resource Website |
RRID:Addgene_104688 | AtUBC23 | Arabidopsis thaliana | Spectinomycin | PMID:29194629 | release insert with BsaI and clone to Level 1 cloning vector | Backbone Marker:self-made; Backbone Size:2251; Vector Backbone:pICH41308; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin | BpiI/BsaI sites removed by point-mutation | Addgene | 2026-10-31 01:56:38 | 0 |
|
pTol1:uas-myc-act-map2k2b-2a-tdTomato Resource Report Resource Website |
RRID:Addgene_104721 | activated map2k2b | Danio rerio | Ampicillin | PMID:27621059 | Vector Backbone:Tol1; Vector Types:zebrafish transposon; Bacterial Resistance:Ampicillin | serines 221 and 225 to aspartic acid | Addgene | 2026-10-31 01:56:39 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
