Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
LSB-hsa-miR-675-3p Resource Report Resource Website |
RRID:Addgene_103720 | hsa-miR-675-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:00:37 | 0 | |
|
LSB-hsa-miR-7-1-3p Resource Report Resource Website |
RRID:Addgene_103722 | hsa-miR-7-1-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:00:35 | 0 | |
|
LSB-hsa-miR-675-5p Resource Report Resource Website |
RRID:Addgene_103721 | hsa-miR-675-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:00:35 | 0 | |
|
1352wUV2 F2bbs kan GCANNNAGGk Resource Report Resource Website |
RRID:Addgene_18752 | 3 tandem zinc fingers | Mus musculus | Ampicillin and Kanamycin | PMID:18500337 | Backbone Size:3890; Vector Backbone:ColE1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | A Kan cassette (1090bp) is inserted between two bbsI sites in finger 2 of this construct. This cassette is here to provide a large drop out band when digested with BbsI. The digested backbone can then be used for building finger 2 libraries. Fingers one and three are anchor fingers which specify AGG and GCA, respectively. | 2026-08-15 01:11:38 | 0 | |
|
1352wUV2 F1bbs kan GCGTGGNNN Resource Report Resource Website |
RRID:Addgene_18753 | 3 tandem zinc fingers | Mus musculus | Ampicillin and Kanamycin | PMID:18500337 | Backbone Size:3890; Vector Backbone:ColE1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | A Kan cassette (1090bp) is inserted between two bbsI sites in finger 1 of this construct. This cassette is here to provide a large drop out band when digested with BbsI. The digested backbone can then be used for building finger 1 libraries. Fingers two and three are anchor fingers which specify GCGTGG. | 2026-08-15 01:11:38 | 0 | |
|
1352wUV2 F3bbs kan NNNTGGGCGk Resource Report Resource Website |
RRID:Addgene_18756 | 3 tandem zinc fingers | Mus musculus | Ampicillin and Kanamycin | PMID:18500337 | Backbone Size:3890; Vector Backbone:ColE1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | A Kan cassette (1090bp) is inserted between two bbsI sites in finger 3 of this construct. This cassette is here to provide a large drop out band when digested with BbsI. The digested backbone can then be used for building finger 3 libraries. Fingers one and two are anchor fingers which specify TGGGCGk. | 2026-08-15 01:11:39 | 0 | |
|
pTA-attP Resource Report Resource Website 1+ mentions |
RRID:Addgene_18939 | phiC31 attP | Streptomyces phage phiC31 | Ampicillin and Kanamycin | PMID:10801973 | Backbone Marker:Invitrogen; Backbone Size:3905; Vector Backbone:pCR2.1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:11:40 | 1 | ||
|
pONSY Resource Report Resource Website 1+ mentions |
RRID:Addgene_111873 | Ampicillin and Kanamycin | PMID:29752387 | Backbone Size:5127; Vector Backbone:pONSY; Vector Types:Capsaspora owczarzaki; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:01:55 | 1 | ||||
|
pONSY-Lifeact:mCherry Resource Report Resource Website |
RRID:Addgene_111876 | Lifeact fused to mCherry | Ampicillin and Kanamycin | PMID:29752387 | Backbone Size:5127; Vector Backbone:pONSY; Vector Types:Capsaspora owczarzaki; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:01:55 | 0 | |||
|
pONSY-mCherry Resource Report Resource Website 1+ mentions |
RRID:Addgene_111874 | mCherry | Ampicillin and Kanamycin | PMID:29752387 | Backbone Size:5127; Vector Backbone:pONSY; Vector Types:Capsaspora owczarzaki; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:01:55 | 1 | |||
|
pONSY-CoNMM:mCherry Resource Report Resource Website 1+ mentions |
RRID:Addgene_111878 | Capsaspora N-Myristoylation motif (CoNMM) from the Src2 gene fused to mCherry | Capsaspora owczarzaki | Ampicillin and Kanamycin | PMID:29752387 | Backbone Size:5127; Vector Backbone:pONSY; Vector Types:Capsaspora owczarzaki; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:01:55 | 2 | ||
|
pMLLKA-J72017 Resource Report Resource Website 1+ mentions |
RRID:Addgene_26008 | N terminal avi tag with RBS | Ampicillin and Kanamycin | Note that this plasmid needs to be grown in both Kanamycin and Ampicillin | Backbone Size:2646; Vector Backbone:pMLL-KA; Vector Types:Synthetic Biology, 2ab assembly vector; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:12:47 | 1 | |||
|
pMLLKA-J72024 Resource Report Resource Website |
RRID:Addgene_26015 | N terminal Strep tag with RBS | Ampicillin and Kanamycin | Note that this plasmid needs to be grown in both Kanamycin and Ampicillin | Backbone Size:2646; Vector Backbone:pMLL-KA; Vector Types:Synthetic Biology, 2ab assembly vector; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:12:47 | 0 | |||
|
pMLLKA-J72027 Resource Report Resource Website |
RRID:Addgene_26018 | N terminal VSV tag with RBS | Ampicillin and Kanamycin | Note that this plasmid needs to be grown in both Kanamycin and Ampicillin | Backbone Size:2646; Vector Backbone:pMLL-KA; Vector Types:Synthetic Biology, 2ab assembly vector; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:12:47 | 0 | |||
|
pMLLKA-J72026 Resource Report Resource Website |
RRID:Addgene_26017 | N terminal V5 tag with RBS | Ampicillin and Kanamycin | Note that this plasmid needs to be grown in both Kanamycin and Ampicillin | Backbone Size:2646; Vector Backbone:pMLL-KA; Vector Types:Synthetic Biology, 2ab assembly vector; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:12:47 | 0 | |||
|
pMLLKA-J72021 Resource Report Resource Website |
RRID:Addgene_26012 | N terminal HSV tag with RBS | Ampicillin and Kanamycin | Note that this plasmid needs to be grown in both Kanamycin and Ampicillin | Backbone Size:2646; Vector Backbone:pMLL-KA; Vector Types:Synthetic Biology, 2ab assembly vector; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:12:47 | 0 | |||
|
pMLLKA-J72020 Resource Report Resource Website |
RRID:Addgene_26011 | N terminal HA tag with RBS | Ampicillin and Kanamycin | Note that this plasmid needs to be grown in both Kanamycin and Ampicillin | Backbone Size:2646; Vector Backbone:pMLL-KA; Vector Types:Synthetic Biology, 2ab assembly vector; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:12:47 | 0 | |||
|
pMLLKA-J72019 Resource Report Resource Website |
RRID:Addgene_26010 | N terminal Flag tag with RBS | Ampicillin and Kanamycin | Note that this plasmid needs to be grown in both Kanamycin and Ampicillin | Backbone Size:2646; Vector Backbone:pMLL-KA; Vector Types:Synthetic Biology, 2ab assembly vector; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:12:50 | 0 | |||
|
pMLLKA-J72039 Resource Report Resource Website |
RRID:Addgene_26184 | Med7 aa102-205 for C-terminal tagging | Saccharomyces cerevisiae | Ampicillin and Kanamycin | Note that this plasmid needs to be grown in both Kanamycin and Ampicillin | Backbone Size:2852; Vector Backbone:pMLL-KA; Vector Types:Synthetic Biology, 2ab assembly vector; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:12:51 | 0 | ||
|
pMLLKA-J72040 Resource Report Resource Website |
RRID:Addgene_26185 | Med21 aa1-132 for C-terminal tagging | Saccharomyces cerevisiae | Ampicillin and Kanamycin | Note that this plasmid needs to be grown in both Kanamycin and Ampicillin | Backbone Size:2852; Vector Backbone:pMLL-KA; Vector Types:Synthetic Biology, 2ab assembly vector; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:12:49 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
