Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

742,877 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pcDNA5-FRT-TO-Nsp16
 
Resource Report
Resource Website
RRID:Addgene_157723 Nsp16 SARS-CoV-2 Ampicillin PMID:33313418 Backbone Marker:Thermo Fisher; Vector Backbone:pcDNA5-FRT-TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin codon optimized 2026-09-19 02:11:43 0
pcDNA5-FRT-TO-Nsp15-HF
 
Resource Report
Resource Website
RRID:Addgene_157722 Nsp15-HF SARS-CoV-2 Ampicillin PMID:33313418 Backbone Marker:Thermo Fisher; Vector Backbone:pcDNA5-FRT-TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin codon optimized 2026-09-19 02:11:43 0
pcDNA5-FRT-TO-Nsp16-HF
 
Resource Report
Resource Website
RRID:Addgene_157725 Nsp16-HF SARS-CoV-2 Ampicillin PMID:33313418 Backbone Marker:Thermo Fisher; Vector Backbone:pcDNA5-FRT-TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin codon optimized 2026-09-19 02:11:43 0
pcDNA5-FRT-TO-FH-Nsp16
 
Resource Report
Resource Website
RRID:Addgene_157724 FH-Nsp16 SARS-CoV-2 Ampicillin PMID:33313418 Backbone Marker:Thermo Fisher; Vector Backbone:pcDNA5-FRT-TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin codon optimized 2026-09-19 02:11:43 0
pcDNA5-FRT-TO-FH-Nsp15
 
Resource Report
Resource Website
RRID:Addgene_157721 FH-Nsp15 SARS-CoV-2 Ampicillin PMID:33313418 Backbone Marker:Thermo Fisher; Vector Backbone:pcDNA5-FRT-TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin codon optimized 2026-09-19 02:11:43 0
pcDNA5-FRT-TO-Nsp15
 
Resource Report
Resource Website
RRID:Addgene_157720 Nsp15 SARS-CoV-2 Ampicillin PMID:33313418 Backbone Marker:Thermo Fisher; Vector Backbone:pcDNA5-FRT-TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin codon optimized 2026-09-19 02:11:43 0
pMBPcyto-TEV-BseRI
 
Resource Report
Resource Website
RRID:Addgene_157739 Ampicillin - Empty vector for cytoplasmic expression of N-terminally His10+MBP-tagged protein of interest, where tag removal by TEV protease yields the native sequence for the protein of interest. - Based on plasmid pET PPL His6 MBP LIC cloning vector (2K-T) (Plasmid #37183), but has the added advantage in leaving no added amino acid residues following cleavage with TEV protease. This advantage is made possible by cloning into the two BseRI restriction sites. - Subcloning requires ligation-independent cloning and use of the two BseRI restriction sites that are present in this empty vector. The two BseRI sites span a removable 432 nucleotide sequence. Cloning into the BseRI-digested vector can be achieved using a ligation-independent system that is dependent on homologous recombination, such as the Takara In-Fusion HD Cloning Plus system, which requires simply designing the PCR-derived insert (containing the protein of interest) to contain 15 bp at each end that matches the 15 bp at each end of the linearized parent vector. In other words, add these 15 bp, AACCTGTACTTCCAA, to the 5' end of the PCR FORWARD primer, and add these 15 bp, CGCGATCGCGGATCC, to the 5' end of the PCR REVERSE primer. - The sequence of the added N-terminus is MKSS + His10 + GSSM + maltose binding protein (aa K27-T392 of NP_290668) + NSSSNNNNNNNNNNLGIE + ENLYFQ*X, where * is the TEV protease cleavage site and X is the N-terminal residue of the introduced protein of interest. Note that TEV protease cleaves most efficiently when X = S, G, A, M; for other compatible residues see Kapust et al 2002, PMID 12074568. - The maltose binding protein tag is the mature form, without its signal sequence, therefore protein expression is directed to the cytoplasm. - BseRI cuts 8-10 nucleotides outside of its own recognition sequence and is a non-palindromic site. The placement & orientation of the two BseRI sites eliminates all of the BseRI recognition sequence in the resulting subclone. - To verify the PCR-generated insert sequence, use sequencing primers MBPpelBseqF (GAAAGGTGAAATCATGCCGAACATC), and pET-PPLseq1R (CTTCCTTTCGGGCTTTGTTAGC) or T7-Ter (GCTAGTTATTGCTCAGCGG). Backbone Size:5942; Vector Backbone:pET PPL His6 MBP LIC cloning vector (2K-T) = Addgene #37183; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:11:43 0
pFastBac1-His10FLAG
 
Resource Report
Resource Website
RRID:Addgene_157736 Ampicillin PMID:33971243 - This vector is designed to avoid adding non-native amino acid residues to the protein of interest, following enterokinase cleavage of the N-terminal purification tags (His10 and 3xFLAG). Subcloning requires ligation-independent cloning and use of the two BseRI restriction sites that are present in this empty vector. The two BseRI sites span a removable 432 nucleotide sequence. Cloning into the BseRI-digested vector can be achieved using a ligation-independent system that is dependent on homologous recombination, such as the Takara In-Fusion HD Cloning Plus system, which requires simply designing the PCR-derived insert (containing the protein of interest) to contain 15 bp at each end that matches the 15 bp at each end of the linearized parent vector. In other words, add these 15 bp, GATGACGATGACAAG, to the 5' end of the PCR FORWARD primer, and add these 15 bp, AGTACTTCTCGACAA, to the 5' end of the PCR REVERSE primer. - The sequence of the N-terminus will be MGSS + His10 + DYKDHDGDYKDHDIDYKDDDDK*X, where * is the enterokinase cleavage site and X is the N-terminus of the protein of interest. For X residues that are compatible with enterokinase activity, see Hosfield & Lu 1999, PMID 10094769. - BseRI cuts 8-10 nucleotides outside of its own recognition sequence and is a non-palindromic site. The placement & orientation of the two BseRI sites eliminates all of the BseRI recognition sequence in the resulting subclone. - An unwanted BseRI site was removed from the parent pFastBac1 vector by introducing a silent mutation (CTC to CTG) in a leucine codon in the gentamicin-resistance gene. - To identify colonies containing a cloned insert, used the primers PFASTBAC1F (CTAGTGGTTGGCTACGTATACTCCG) and PFASTBAC1R (GGACAAACCACAACTAGAATGCAGTG). - To verify the PCR-generated insert sequence, use sequencing primers POLYHEDF (AAATGATAACCATCTCGC), SV40PAR (GAAATTTGTGATGCTATTGC). - To verify Tn7-based incorporation of the expression construct into the bacmid DNA in the E. coli strain DH10Bac, use PCR primers BACM13F (CCCAGTCACGACGTTGTAAAACG) and BACM13R (AGCGGATAACAATTTCACACAGG). A bacmid containing the correct insert has a PCR product size of ~2300 base pairs plus the length of the added insert. Backbone Marker:Invitrogen; Backbone Size:4682; Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:11:43 0
pcDNA-FRT-TO-Nprot_GC3opt
 
Resource Report
Resource Website
RRID:Addgene_157730 Nprot_GC3opt SARS-CoV-2 Ampicillin PMID:33313418 Backbone Marker:Thermo Fisher; Vector Backbone:pcDNA5-FRT-TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin codon optimized; gene expression was optimized by increasing the GC3 content within codons 2026-09-19 02:11:43 0
pcDNA5-FRT-TO-Nprot-HF_GC3opt
 
Resource Report
Resource Website
RRID:Addgene_157732 Nprot-HF_GC3opt SARS-CoV-2 Ampicillin PMID:33313418 Backbone Marker:Thermo Fisher; Vector Backbone:pcDNA5-FRT-TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin codon optimized; gene expression was optimized by increasing the GC3 content within codons 2026-09-19 02:11:43 0
pcDNA 3.1 AURKA deltaNter
 
Resource Report
Resource Website
RRID:Addgene_157749 AURKA Homo sapiens Ampicillin PMID:30070631 Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin the first 30AA of Aurora A are lacking 2026-09-19 02:11:43 0
Plasmid EUPp_09
 
Resource Report
Resource Website
RRID:Addgene_157745 acetaldehyde dehydrogenase Dickeya zeae Ampicillin PMID:33248272 Backbone Size:2502; Vector Backbone:PgyrA_pMB1_ampR; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:11:43 0
CaTCH_empty-backbone
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_157746 Ampicillin PMID:32719478 mCMV_eGFP_EF1as_eBFP2 Vector Backbone:pRRL; Vector Types:Mammalian Expression, Lentiviral, CaTCH barcode cloning; Bacterial Resistance:Ampicillin 2026-09-19 02:11:43 1
pelBHisTEV
 
Resource Report
Resource Website
RRID:Addgene_157741 Kanamycin - Empty vector (kanamycin-R) adds TEV-protease-removable N-terminal PelB signal sequence + His10, plus potential C-term His6. Non-leaky expression due to T7lac promoter. - Has an advantage in leaving no added amino acid residues following TEV protease cleavage of PelB signal sequence + His10. This advantage is made possible by cloning into the two BseRI restriction sites. - Subcloning requires ligation-independent cloning and use of the two BseRI restriction sites that are present in this empty vector. The two BseRI sites span a removable 432 nucleotide sequence. Cloning into the BseRI-digested vector can be achieved using a ligation-independent system that is dependent on homologous recombination, such as the Takara In-Fusion HD Cloning Plus system, which requires simply designing the PCR-derived insert (containing the protein of interest) to contain 15 bp at each end that matches the 15 bp at each end of the linearized parent vector. In other words, add these 15 bp, AACCTGTACTTCCAA, to the 5' end of the PCR FORWARD primer, and add these 15 bp, GTGGTGGTGCTCGAG, to the 5' end of the PCR REVERSE primer. - The sequence of the added N-terminus is the PelB signal sequence (M1-A22 of GenBank #AAA24848) + 13 aa linker + His10-tag + 4 aa linker + TEV protease cleavage site. The N-terminal protein sequence is: MKYLLPTAAAGLLLLAAQPAMA + MDIGINSDPNSSS + HHHHHHHHHH + PMGS + ENLYFQ*X, where * is the TEV protease cleavage site and X is the N-terminal residue of the introduced protein of interest. Note that TEV protease cleaves most efficiently when X = S, G, A, M; for other compatible residues see Kapust et al 2002, PMID 12074568. - A C-terminal His6-tag is possible: if no stop codon is included in the cloned insert, the sequence LEHHHHHH is added to the C-terminus. - The PelB signal sequence directs the protein of interest to the E. coli inner membrane. Whether the protein traverses the inner membrane is dependent on the protein of interest. - BseRI cuts 8-10 nucleotides outside of its own recognition sequence and is a non-palindromic site. The placement & orientation of the two BseRI sites eliminates all of the BseRI recognition sequence in the resulting subclone. - To verify the PCR-generated insert sequence, use sequencing primers T7 (TAATACGACTCACTATAGGG), T7-Ter (GCTAGTTATTGCTCAGCGG). Backbone Size:5401; Vector Backbone:pelB-MBP (DNASU access. no. EvNO00813783); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-09-19 02:11:43 0
pEGFP N1 AURKA 1-110
 
Resource Report
Resource Website
RRID:Addgene_157755 AURKA Homo sapiens Kanamycin PMID:30070631 Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin The first 110 amino acids of AURKA were cloned 2026-09-19 02:11:43 0
pcDNA 3.1 mitoAURKA
 
Resource Report
Resource Website
RRID:Addgene_157750 AURKA Homo sapiens Ampicillin PMID:30070631 Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Aurora A without the first 30AA + MTS of CoxVIII 2026-09-19 02:11:43 0
pET19b+H3
 
Resource Report
Resource Website
RRID:Addgene_157807 H3 Homo sapiens Ampicillin PMID:31543265 Vector Backbone:pET19b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin C111A 2026-09-19 02:11:44 0
pET19b+H2B
 
Resource Report
Resource Website
RRID:Addgene_157809 H2B Homo sapiens Ampicillin PMID:31543265 Vector Backbone:pET19b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:11:44 0
pMTTH+eGFP-bromo5
 
Resource Report
Resource Website
RRID:Addgene_157804 eGFP-bromo5 Homo sapiens Ampicillin PMID:31543265 Vector Backbone:modified pMal (MTTH); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:11:44 0
pMTTH+bromo5
 
Resource Report
Resource Website
RRID:Addgene_157803 bromo5 Homo sapiens Ampicillin PMID:31543265 Vector Backbone:modified pMal (MTTH); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:11:44 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.