Plasmids   Select Another Resource Report Type

http://www.addgene.org/157723

Species: SARS-CoV-2
Genetic Insert: Nsp16
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pcDNA5-FRT-TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33313418

Proper citation: RRID:Addgene_157723 Copy   

•   Source: Addgene

http://www.addgene.org/157722

Species: SARS-CoV-2
Genetic Insert: Nsp15-HF
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pcDNA5-FRT-TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33313418

Proper citation: RRID:Addgene_157722 Copy   

•   Source: Addgene

http://www.addgene.org/157725

Species: SARS-CoV-2
Genetic Insert: Nsp16-HF
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pcDNA5-FRT-TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33313418

Proper citation: RRID:Addgene_157725 Copy   

•   Source: Addgene

http://www.addgene.org/157724

Species: SARS-CoV-2
Genetic Insert: FH-Nsp16
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pcDNA5-FRT-TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33313418

Proper citation: RRID:Addgene_157724 Copy   

•   Source: Addgene

http://www.addgene.org/157721

Species: SARS-CoV-2
Genetic Insert: FH-Nsp15
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pcDNA5-FRT-TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33313418

Proper citation: RRID:Addgene_157721 Copy   

•   Source: Addgene

http://www.addgene.org/157720

Species: SARS-CoV-2
Genetic Insert: Nsp15
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pcDNA5-FRT-TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33313418

Proper citation: RRID:Addgene_157720 Copy   

•   Source: Addgene

http://www.addgene.org/157739

Vector Backbone Description: Backbone Size:5942; Vector Backbone:pET PPL His6 MBP LIC cloning vector (2K-T) = Addgene #37183; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: - Empty vector for cytoplasmic expression of N-terminally His10+MBP-tagged protein of interest, where tag removal by TEV protease yields the native sequence for the protein of interest. - Based on plasmid pET PPL His6 MBP LIC cloning vector (2K-T) (Plasmid #37183), but has the added advantage in leaving no added amino acid residues following cleavage with TEV protease. This advantage is made possible by cloning into the two BseRI restriction sites. - Subcloning requires ligation-independent cloning and use of the two BseRI restriction sites that are present in this empty vector. The two BseRI sites span a removable 432 nucleotide sequence. Cloning into the BseRI-digested vector can be achieved using a ligation-independent system that is dependent on homologous recombination, such as the Takara In-Fusion HD Cloning Plus system, which requires simply designing the PCR-derived insert (containing the protein of interest) to contain 15 bp at each end that matches the 15 bp at each end of the linearized parent vector. In other words, add these 15 bp, AACCTGTACTTCCAA, to the 5' end of the PCR FORWARD primer, and add these 15 bp, CGCGATCGCGGATCC, to the 5' end of the PCR REVERSE primer. - The sequence of the added N-terminus is MKSS + His10 + GSSM + maltose binding protein (aa K27-T392 of NP_290668) + NSSSNNNNNNNNNNLGIE + ENLYFQ*X, where * is the TEV protease cleavage site and X is the N-terminal residue of the introduced protein of interest. Note that TEV protease cleaves most efficiently when X = S, G, A, M; for other compatible residues see Kapust et al 2002, PMID 12074568. - The maltose binding protein tag is the mature form, without its signal sequence, therefore protein expression is directed to the cytoplasm. - BseRI cuts 8-10 nucleotides outside of its own recognition sequence and is a non-palindromic site. The placement & orientation of the two BseRI sites eliminates all of the BseRI recognition sequence in the resulting subclone. - To verify the PCR-generated insert sequence, use sequencing primers MBPpelBseqF (GAAAGGTGAAATCATGCCGAACATC), and pET-PPLseq1R (CTTCCTTTCGGGCTTTGTTAGC) or T7-Ter (GCTAGTTATTGCTCAGCGG).

Proper citation: RRID:Addgene_157739 Copy   

•   Source: Addgene

http://www.addgene.org/157736

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4682; Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33971243
Comments: - This vector is designed to avoid adding non-native amino acid residues to the protein of interest, following enterokinase cleavage of the N-terminal purification tags (His10 and 3xFLAG). Subcloning requires ligation-independent cloning and use of the two BseRI restriction sites that are present in this empty vector. The two BseRI sites span a removable 432 nucleotide sequence. Cloning into the BseRI-digested vector can be achieved using a ligation-independent system that is dependent on homologous recombination, such as the Takara In-Fusion HD Cloning Plus system, which requires simply designing the PCR-derived insert (containing the protein of interest) to contain 15 bp at each end that matches the 15 bp at each end of the linearized parent vector. In other words, add these 15 bp, GATGACGATGACAAG, to the 5' end of the PCR FORWARD primer, and add these 15 bp, AGTACTTCTCGACAA, to the 5' end of the PCR REVERSE primer. - The sequence of the N-terminus will be MGSS + His10 + DYKDHDGDYKDHDIDYKDDDDK*X, where * is the enterokinase cleavage site and X is the N-terminus of the protein of interest. For X residues that are compatible with enterokinase activity, see Hosfield & Lu 1999, PMID 10094769. - BseRI cuts 8-10 nucleotides outside of its own recognition sequence and is a non-palindromic site. The placement & orientation of the two BseRI sites eliminates all of the BseRI recognition sequence in the resulting subclone. - An unwanted BseRI site was removed from the parent pFastBac1 vector by introducing a silent mutation (CTC to CTG) in a leucine codon in the gentamicin-resistance gene. - To identify colonies containing a cloned insert, used the primers PFASTBAC1F (CTAGTGGTTGGCTACGTATACTCCG) and PFASTBAC1R (GGACAAACCACAACTAGAATGCAGTG). - To verify the PCR-generated insert sequence, use sequencing primers POLYHEDF (AAATGATAACCATCTCGC), SV40PAR (GAAATTTGTGATGCTATTGC). - To verify Tn7-based incorporation of the expression construct into the bacmid DNA in the E. coli strain DH10Bac, use PCR primers BACM13F (CCCAGTCACGACGTTGTAAAACG) and BACM13R (AGCGGATAACAATTTCACACAGG). A bacmid containing the correct insert has a PCR product size of ~2300 base pairs plus the length of the added insert.

Proper citation: RRID:Addgene_157736 Copy   

•   Source: Addgene

http://www.addgene.org/157730

Species: SARS-CoV-2
Genetic Insert: Nprot_GC3opt
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pcDNA5-FRT-TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33313418

Proper citation: RRID:Addgene_157730 Copy   

•   Source: Addgene

http://www.addgene.org/157732

Species: SARS-CoV-2
Genetic Insert: Nprot-HF_GC3opt
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pcDNA5-FRT-TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33313418

Proper citation: RRID:Addgene_157732 Copy   

•   Source: Addgene

http://www.addgene.org/157749

Species: Homo sapiens
Genetic Insert: AURKA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30070631

Proper citation: RRID:Addgene_157749 Copy   

•   Source: Addgene

http://www.addgene.org/157745

Species: Dickeya zeae
Genetic Insert: acetaldehyde dehydrogenase
Vector Backbone Description: Backbone Size:2502; Vector Backbone:PgyrA_pMB1_ampR; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33248272

Proper citation: RRID:Addgene_157745 Copy   

•   Source: Addgene

http://www.addgene.org/157746

Vector Backbone Description: Vector Backbone:pRRL; Vector Types:Mammalian Expression, Lentiviral, CaTCH barcode cloning; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32719478
Comments: mCMV_eGFP_EF1as_eBFP2

Proper citation: RRID:Addgene_157746 Copy   

•   Source: Addgene

http://www.addgene.org/157741

Vector Backbone Description: Backbone Size:5401; Vector Backbone:pelB-MBP (DNASU access. no. EvNO00813783); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: - Empty vector (kanamycin-R) adds TEV-protease-removable N-terminal PelB signal sequence + His10, plus potential C-term His6. Non-leaky expression due to T7lac promoter. - Has an advantage in leaving no added amino acid residues following TEV protease cleavage of PelB signal sequence + His10. This advantage is made possible by cloning into the two BseRI restriction sites. - Subcloning requires ligation-independent cloning and use of the two BseRI restriction sites that are present in this empty vector. The two BseRI sites span a removable 432 nucleotide sequence. Cloning into the BseRI-digested vector can be achieved using a ligation-independent system that is dependent on homologous recombination, such as the Takara In-Fusion HD Cloning Plus system, which requires simply designing the PCR-derived insert (containing the protein of interest) to contain 15 bp at each end that matches the 15 bp at each end of the linearized parent vector. In other words, add these 15 bp, AACCTGTACTTCCAA, to the 5' end of the PCR FORWARD primer, and add these 15 bp, GTGGTGGTGCTCGAG, to the 5' end of the PCR REVERSE primer. - The sequence of the added N-terminus is the PelB signal sequence (M1-A22 of GenBank #AAA24848) + 13 aa linker + His10-tag + 4 aa linker + TEV protease cleavage site. The N-terminal protein sequence is: MKYLLPTAAAGLLLLAAQPAMA + MDIGINSDPNSSS + HHHHHHHHHH + PMGS + ENLYFQ*X, where * is the TEV protease cleavage site and X is the N-terminal residue of the introduced protein of interest. Note that TEV protease cleaves most efficiently when X = S, G, A, M; for other compatible residues see Kapust et al 2002, PMID 12074568. - A C-terminal His6-tag is possible: if no stop codon is included in the cloned insert, the sequence LEHHHHHH is added to the C-terminus. - The PelB signal sequence directs the protein of interest to the E. coli inner membrane. Whether the protein traverses the inner membrane is dependent on the protein of interest. - BseRI cuts 8-10 nucleotides outside of its own recognition sequence and is a non-palindromic site. The placement & orientation of the two BseRI sites eliminates all of the BseRI recognition sequence in the resulting subclone. - To verify the PCR-generated insert sequence, use sequencing primers T7 (TAATACGACTCACTATAGGG), T7-Ter (GCTAGTTATTGCTCAGCGG).

Proper citation: RRID:Addgene_157741 Copy   

•   Source: Addgene

http://www.addgene.org/157755

Species: Homo sapiens
Genetic Insert: AURKA
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30070631

Proper citation: RRID:Addgene_157755 Copy   

•   Source: Addgene

http://www.addgene.org/157750

Species: Homo sapiens
Genetic Insert: AURKA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30070631

Proper citation: RRID:Addgene_157750 Copy   

•   Source: Addgene

http://www.addgene.org/157807

Species: Homo sapiens
Genetic Insert: H3
Vector Backbone Description: Vector Backbone:pET19b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31543265

Proper citation: RRID:Addgene_157807 Copy   

•   Source: Addgene

http://www.addgene.org/157809

Species: Homo sapiens
Genetic Insert: H2B
Vector Backbone Description: Vector Backbone:pET19b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31543265

Proper citation: RRID:Addgene_157809 Copy   

•   Source: Addgene

http://www.addgene.org/157804

Species: Homo sapiens
Genetic Insert: eGFP-bromo5
Vector Backbone Description: Vector Backbone:modified pMal (MTTH); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31543265

Proper citation: RRID:Addgene_157804 Copy   

•   Source: Addgene

http://www.addgene.org/157803

Species: Homo sapiens
Genetic Insert: bromo5
Vector Backbone Description: Vector Backbone:modified pMal (MTTH); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31543265

Proper citation: RRID:Addgene_157803 Copy   

•   Source: Addgene