SYSTEM UPDATE: We will be performing system maintenace Saturday September 26 at 9pm to midnight Pacific Time

Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 401 showing 8001 ~ 8020 out of 743,073 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/156392

Species: Other
Genetic Insert: Venus
Vector Backbone Description: Backbone Size:7469; Vector Backbone:pTYF; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451217

Proper citation: RRID:Addgene_156392 Copy   


  • RRID:Addgene_15712

    This resource has 1+ mentions.

http://www.addgene.org/15712

Species: Homo sapiens
Genetic Insert: LAP2
Vector Backbone Description: Backbone Marker:Available at Addgene (#1764); Backbone Size:5169; Vector Backbone:pBABE puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16959612
Comments: Human LAP2 was cloned by PCR from cDNA template and then digested with EcoR1/SalI and inserted in pBabe-Puro.

Proper citation: RRID:Addgene_15712 Copy   


http://www.addgene.org/15678

Species: Rattus norvegicus
Genetic Insert: mTOR
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12370290
Comments: See author's map for detailed information.

Proper citation: RRID:Addgene_15678 Copy   


http://www.addgene.org/15711

Species: Homo sapiens
Genetic Insert: p15 promoter
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pGL2-E1bTATA; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16959612
Comments: SBR2 is one of the Smad Binding Regions on the promoter

Proper citation: RRID:Addgene_15711 Copy   


  • RRID:Addgene_15672

    This resource has 1+ mentions.

http://www.addgene.org/15672

Species: Mus musculus
Genetic Insert: PRAS40 shRNA
Vector Backbone Description: Backbone Marker:Available at Addgene (#8453); Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17510057
Comments: Oligonucleotides encoding the short-hairpin RNA expression cassette targeting mouse PRAS40 from base 753-773 (GI:124376717) were annealed and subcloned into pLKO.1. See author's map for shRNA sequence information.

Proper citation: RRID:Addgene_15672 Copy   


  • RRID:Addgene_15670

    This resource has 1+ mentions.

http://www.addgene.org/15670

Vector Backbone Description: Backbone Size:8081; Vector Backbone:pCM433; Vector Types:bacterial allelic exchange vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:18710539
Comments: Ampicillin, Chloramphenicol, Tetracycline

Proper citation: RRID:Addgene_15670 Copy   


  • RRID:Addgene_1573

http://www.addgene.org/1573

Vector Backbone Description: Backbone Size:6921; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See Fire Lab Vector Kit Documentation 1997. Fire Lab Miniprep Number pPD115.107, Ligation number L3608.

Proper citation: RRID:Addgene_1573 Copy   


http://www.addgene.org/15718

Species: Homo sapiens
Genetic Insert: p15 4xSBR1
Vector Backbone Description: Backbone Size:5600; Vector Backbone:pGL2-E1bTATA; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16959612
Comments: SBR1 is one of the Smad Binding Regions on the p15INK4b promoter. Smad binding element sequence - ACTAATTCGGGCAGAAAGACACATCCAAGAGAA

Proper citation: RRID:Addgene_15718 Copy   


  • RRID:Addgene_15688

http://www.addgene.org/15688

Species: Mus musculus
Genetic Insert: ERas
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pCAG-IH; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12774123

Proper citation: RRID:Addgene_15688 Copy   


  • RRID:Addgene_15721

    This resource has 1+ mentions.

http://www.addgene.org/15721

Species: Homo sapiens
Genetic Insert: TIF1 gamma shRNA
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pRetrosuper-GFP; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16751102
Comments: shRNA oligos were first cloned into pRetrosuper-Puro digested with BglII and HindIII. Next, the AgeI/XhoI fragments from shRNA sequence-containing pRetrosuper-Puro plasmids were cloned into the AgeI/XhoI site of pRetrosuper-GFP. Sense oligo: 5'-gatcccc GAAGATGTCT CAGAGTCTG ttcaagaga CAGACTCTGA GACATCTTC tttttggaaa-3'.

Proper citation: RRID:Addgene_15721 Copy   


  • RRID:Addgene_15682

    This resource has 10+ mentions.

http://www.addgene.org/15682

Species: Homo sapiens
Genetic Insert: YAP
Vector Backbone Description: Backbone Marker:Available at Addgene (#1764); Backbone Size:5169; Vector Backbone:pBABE puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16894141
Comments: The human YAP ORF was cloned into the pBABEpuro vector as an EcoRI–BamHI fragment. A single FLAG tag was added to the N terminus during PCR with the following primers: Hs.YAP.F, CCGGGATCCACCATGGATTACAAGGATGACGACGATAAGATGGACCCCGGGCAGCAGCCCGCCGC; and Hs.YAP.R, CCGGAATTCCTATAACCATGTAAGAAAGCTTTC.

Proper citation: RRID:Addgene_15682 Copy   


  • RRID:Addgene_15680

http://www.addgene.org/15680

Species: Rattus norvegicus
Genetic Insert: PHAS-I F113A
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4671; Vector Backbone:pET14b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12665511
Comments: Full-length PHASI with a His tag. See author's map for detailed information.

Proper citation: RRID:Addgene_15680 Copy   


  • RRID:Addgene_156459

http://www.addgene.org/156459

Species: Rattus norvegicus
Genetic Insert: rApoI
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:29991261
Comments: Esherichia coli strain that expresses rat APOBEC1. Genotype: DH10B Δung ΔmotAB ΔcsgABCDEFG [PlacI<>Ptac] Δ(araA-leu)7697::[PA1lacO-Tenth rApo1]

Proper citation: RRID:Addgene_156459 Copy   


http://www.addgene.org/156454

Species: Tn5
Genetic Insert: NeoR/KanR
Vector Backbone Description: Backbone Size:5863; Vector Backbone:BAC; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29991261
Comments: Please note that a low DNA yield is expected with single copy BACs. Using larger scale DNA preps (ie. midi preps) is recommended. If there are difficulties removing genomic DNA, the ExonucleaseV (recBCD) from NEB (M0345S) which degrades contaminating linear DNA can help improve results.

Proper citation: RRID:Addgene_156454 Copy   


  • RRID:Addgene_1566

http://www.addgene.org/1566

Vector Backbone Description: Backbone Size:6921; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See Fire Lab Vector Kit Documentation 1997. Fire Lab Miniprep Number pPD115.70, Ligation number L3574.

Proper citation: RRID:Addgene_1566 Copy   


http://www.addgene.org/156455

Species: Escherichia coli
Genetic Insert: rpsL
Vector Backbone Description: Backbone Size:4732; Vector Backbone:BAC; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29991261
Comments: Please note that a low DNA yield is expected with single copy BACs. Using larger scale DNA preps (ie. midi preps) is recommended. If there are difficulties removing genomic DNA, the ExonucleaseV (recBCD) from NEB (M0345S) which degrades contaminating linear DNA can help improve results.

Proper citation: RRID:Addgene_156455 Copy   


  • RRID:Addgene_1569

http://www.addgene.org/1569

Vector Backbone Description: Backbone Size:4816; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See Fire Lab Vector Kit Documentation 1997. Fire Lab Miniprep Number pPD115.99, Ligation number L3604.

Proper citation: RRID:Addgene_1569 Copy   


  • RRID:Addgene_15728

    This resource has 1+ mentions.

http://www.addgene.org/15728

Species: Homo sapiens
Genetic Insert: TIF1 gamma shRNA
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pRetrosuper; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16751102
Comments: shRNA oligos were cloned into pRetrosuper-Puro digested with BglII and HindIII. Sense oligo: 5'-gatcccc GAAGATGTCT CAGAGTCTG ttcaagaga CAGACTCTGA GACATCTTC tttttggaaa-3'.

Proper citation: RRID:Addgene_15728 Copy   


http://www.addgene.org/15658

Species: Mus musculus
Genetic Insert: HybridJ-IRES-tauGFP LNL TV
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBS; Vector Types:high copy number; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15186781
Comments: The mouse strain that was derived from this plasmid is available from The Jackson Laboratory: http://jaxmice.jax.org/strain/006622.html

Proper citation: RRID:Addgene_15658 Copy   


http://www.addgene.org/15656

Species: Mus musculus
Genetic Insert: HybridH-IRES-tauGFP LNL TV
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBS; Vector Types:high copy number; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15186781
Comments: The mouse strain that was derived from this plasmid is available from The Jackson Laboratory: http://jaxmice.jax.org/strain/006624.html

Proper citation: RRID:Addgene_15656 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X