Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:e. coli (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

1,737 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pNP2157
 
Resource Report
Resource Website 		RRID:Addgene_222732 IS621 Helper (WT) E. coli Chloramphenicol PMID:38926615 Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint. Vector Backbone:pNP1950 - p15A Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-15 01:30:16 0
pNP1954
 
Resource Report
Resource Website 		RRID:Addgene_222730 IS621 bridge RNA E. coli Kanamycin PMID:38926615 Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint. Vector Backbone:pNP1723 - ColE1 Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:30:15 0
eScaf
 
Resource Report
Resource Website 		RRID:Addgene_220921 Genotype: F’[traD36 lacIq lacZ ∆M15 proA+B+] glnV (supE) thi-1 ∆(mcrB-hsdSM)5 (rK- mK- McrB-) ∆(lac-proAB) ulaD::M13 E. coli None PMID:38499480 Primers for validation Pair 1: agtaaggacgcgccatgaaa + agcgaaagacagcatcggaa (Ta = 59 C, should have 2526 bp product) Pair 2: aatcggttgaatgtcgccct + gggaaacgacgatgagcaga (Ta = 59, should have 3900 bp product) Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None 2026-08-15 01:30:20 0
PT7lacO-His6-AsnRS
 
Resource Report
Resource Website 		RRID:Addgene_224363 AsnRS E. coli Ampicillin PMID:40209036 It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint. Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:24 0
PT7lacO-His6-PheRSa-PheRSb
 
Resource Report
Resource Website 		RRID:Addgene_224364 PheRS E. coli Ampicillin PMID:40209036 It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint. Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:24 0
PT7lacO-His6-IF2
 
Resource Report
Resource Website 		RRID:Addgene_224367 IF2 E. coli Ampicillin PMID:40209036 It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint. Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:25 0
PT7lacO-His6-NDK
 
Resource Report
Resource Website 		RRID:Addgene_224376 NDK E. coli Ampicillin PMID:40209036 It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint. Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:25 0
PT7lacO-RRF-His6
 
Resource Report
Resource Website 		RRID:Addgene_224374 RRF E. coli Ampicillin PMID:40209036 It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint. Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:25 0
PT7lacO-RF1-His6
 
Resource Report
Resource Website 		RRID:Addgene_224372 RF1 E. coli Ampicillin PMID:40209036 It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint. Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:25 0
PT7lacO-EF-Tu-His8
 
Resource Report
Resource Website 		RRID:Addgene_224370 EF-Tu E. coli Ampicillin PMID:40209036 It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint. Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:25 0
pGLU_103
 
Resource Report
Resource Website 		RRID:Addgene_225785 Ptn5_[Tn5] E. Coli Chloramphenicol Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol N/A 2026-08-15 01:30:45 0
pJMP8045
 
Resource Report
Resource Website 		RRID:Addgene_220900 tnsABCD E. coli Spectinomycin PMID:39324814 Needs to be grown in E. coli BW25141 (pir+ strain with an anti-CRISPR protein on the chromosome) Please visit https://pubmed.ncbi.nlm.nih.gov/37662258/ for bioRxiv preprint. Vector Backbone:pIND4; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin 2026-08-15 01:30:44 0
pCTK109
 
Resource Report
Resource Website 		RRID:Addgene_248472 L3S3P11 E. coli Chloramphenicol PMID:41581077 Type 4 pasts are terminators in the CTK system Please note: This plasmid contains a C nucleotide insertion in L3S3P11. This insertion is not known to impact plasmid function. Vector Backbone:pYTK001; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol None 2026-08-15 01:36:11 0
3xFLAG-TurboID
 
Resource Report
Resource Website 		RRID:Addgene_236117 TurboID E. coli Ampicillin Addgene NGS finds the 3x-FLAG tag C-terminal on the insert. Backbone Marker:Invitrogen; Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:36:26 0
CCLMPC_CAT
 
Resource Report
Resource Website 		RRID:Addgene_237500 Chloramphenicol acetyl transferase fusion protein E. coli Ampicillin PMID:40536430 Vector Backbone:CCLMPC; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:35:00 0
pTE5602
 
Resource Report
Resource Website 		RRID:Addgene_250510 T7-proOmpA-pep99 E. coli Kanamycin Please visit https://doi.org/10.64898/2025.12.09.688994 for bioRxiv preprint. Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:35:04 0
pTE5627
 
Resource Report
Resource Website 		RRID:Addgene_250516 T7-secY(I408G)EG E. coli Kanamycin Please visit https://doi.org/10.64898/2025.12.09.688994 for bioRxiv preprint. Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin I408G 2026-08-15 01:35:04 0
pTE5607
 
Resource Report
Resource Website 		RRID:Addgene_250513 T7-secYEG E. coli Kanamycin Please visit https://doi.org/10.64898/2025.12.09.688994 for bioRxiv preprint. Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:35:04 0
pTE5605
 
Resource Report
Resource Website 		RRID:Addgene_250512 T7-secY(P84L)EG E. coli Kanamycin Please visit https://doi.org/10.64898/2025.12.09.688994 for bioRxiv preprint. Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin P84L 2026-08-15 01:35:04 0
pCODE-2
 
Resource Report
Resource Website 		RRID:Addgene_247474 argX, glyT, leuW, proL, argU, and ileX E. coli Ampicillin PMID:42014348 Backbone Size:3924; Vector Backbone:pSEVA121; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Rearrangement of tRNA operon 2026-08-15 01:35:11 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch