Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
ADH5_KG Resource Report Resource Website |
RRID:Addgene_224150 | ADH-5 | Caenorhabditis elegans | Ampicillin | Vector Backbone:pET303/CT-His; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:33:48 | 0 | |||
|
MBP-GFP-RGG Resource Report Resource Website |
RRID:Addgene_242453 | MBP-GFP-RGG | Caenorhabditis elegans | Kanamycin | PMID:34916288 | The depositor confirms that discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences. | Backbone Size:5210; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:33:50 | 0 | |
|
GST-GFP-RGG Resource Report Resource Website |
RRID:Addgene_242454 | GST-GFP-RGG | Caenorhabditis elegans | Kanamycin | PMID:34916288 | The depositor confirms that discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences. | Backbone Size:5210; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:33:51 | 0 | |
|
MBP-Streptavidin-RGG Resource Report Resource Website |
RRID:Addgene_242451 | MBP-Streptavidin-RGG (using LAF-1 RGG domain) | Caenorhabditis elegans | Kanamycin | PMID:40229261 | The depositor confirms that discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences. | Backbone Size:4208; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:33:51 | 0 | |
|
pBD30 Resource Report Resource Website |
RRID:Addgene_245767 | rap-1::mCherry | Caenorhabditis elegans | Ampicillin | PMID:40748210 | Vector Backbone:pDEST; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:34:03 | 0 | ||
|
pBD28 Resource Report Resource Website |
RRID:Addgene_245766 | tiam-1::mGFP | Caenorhabditis elegans | Spectinomycin | PMID:40748210 | Vector Backbone:pCR8/GW/TOPO; Vector Types:Unspecified; Bacterial Resistance:Spectinomycin | 2026-08-15 01:34:01 | 0 | ||
|
pREA16 Resource Report Resource Website |
RRID:Addgene_245771 | mCherry::RBD::T2A::rac-2::mGFP | Caenorhabditis elegans | Ampicillin | PMID:40748210 | Vector Backbone:pDEST; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:34:01 | 0 | ||
|
pREA12 Resource Report Resource Website |
RRID:Addgene_245770 | mCherry::RBD::T2A::rac-2::mGFP | Caenorhabditis elegans | Spectinomycin | PMID:40748210 | Vector Backbone:pCR8/GW/TOPO; Vector Types:Unspecified; Bacterial Resistance:Spectinomycin | 2026-08-15 01:34:03 | 0 | ||
|
pSJC319 Resource Report Resource Website |
RRID:Addgene_245775 | rap-1(G12V)::mGFP | Caenorhabditis elegans | Ampicillin | PMID:40748210 | Vector Backbone:pDEST; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | G12V | 2026-08-15 01:34:01 | 0 | |
|
pSJC318 Resource Report Resource Website |
RRID:Addgene_245774 | rac-2(G12V)::mGFP | Caenorhabditis elegans | Spectinomycin | PMID:40748210 | Vector Backbone:pCR8/GW/TOPO; Vector Types:Unspecified; Bacterial Resistance:Spectinomycin | G12V | 2026-08-15 01:34:01 | 0 | |
|
pSJC321 Resource Report Resource Website |
RRID:Addgene_245777 | rac-2(G12V)::mGFP | Caenorhabditis elegans | Ampicillin | PMID:40748210 | Vector Backbone:pDEST; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | G12V | 2026-08-15 01:34:01 | 0 | |
|
Ce iPGM-C-HiBiT Resource Report Resource Website 1+ mentions |
RRID:Addgene_207120 | C. elegans-iPGM HiBIT His10 | Caenorhabditis elegans | Ampicillin | PMID:40346061 | Backbone Marker:EMD Biosciences (Novagen); Backbone Size:5443; Vector Backbone:pET21a (+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Codon optmization for expression in BL21DE3 | 2026-08-15 01:32:50 | 1 | |
|
pCI_AFF-1-FLAG_H2B-RFP Resource Report Resource Website |
RRID:Addgene_240506 | AFF-1 | Caenorhabditis elegans | Ampicillin | PMID:35794124 | Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:33:35 | 0 | ||
|
pcDNA 3.3 N-MYC pdzd-8 Resource Report Resource Website |
RRID:Addgene_227844 | pdzd-8 | Caenorhabditis elegans | Ampicillin | PMID:38898113 | Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:33:09 | 0 | ||
|
pcDNA 3.3 C-MYC pdzd-8(536A) Resource Report Resource Website |
RRID:Addgene_227885 | pdzd-8 | Caenorhabditis elegans | Ampicillin | PMID:38898113 | Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | S536A | 2026-08-15 01:33:18 | 0 | |
|
pREA2 Resource Report Resource Website |
RRID:Addgene_245831 | rac-2 | Caenorhabditis elegans | Ampicillin | PMID:40748210 | Vector Backbone:pDEST; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:34:16 | 0 | ||
|
pREA3 Resource Report Resource Website |
RRID:Addgene_245832 | rac-2(G12V) | Caenorhabditis elegans | Ampicillin | PMID:40748210 | Vector Backbone:pDEST; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | G12V | 2026-08-15 01:34:16 | 0 | |
|
pDV06 [punc-17::SNG-1::CRY2(535)] Resource Report Resource Website |
RRID:Addgene_197597 | Synaptogyrin-CRY2 (E490G + residues 1-535) | Caenorhabditis elegans | Ampicillin | PMID:36535932 | Backbone Marker:J. Rand; Vector Backbone:RM#348p; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | E490G | 2026-08-15 01:28:26 | 0 | |
|
pSAH66 - [BAGp | gfp | tbb-2 UTR] Resource Report Resource Website |
RRID:Addgene_200340 | [BAGp | gfp | tbb-2 UTR] | Caenorhabditis elegans | Ampicillin | See www.wormbuilder.org/BioParts for more information. | Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:28:29 | 0 | ||
|
pZCS41 (U6p::GCGAAGTGACGGTAGACCGT) Resource Report Resource Website 1+ mentions |
RRID:Addgene_193050 | Guide RNA | Caenorhabditis elegans | Ampicillin | PMID:37401921 | Please visit https://www.biorxiv.org/content/10.1101/2022.10.30.514301v1 for bioRxiv preprint. | Backbone Marker:Phillips Lab; Backbone Size:3233; Vector Backbone:pZCS11; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:27:49 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.