Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Organism:caenorhabditis elegans (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

1,881 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
ADH5_KG
 
Resource Report
Resource Website
RRID:Addgene_224150 ADH-5 Caenorhabditis elegans Ampicillin Vector Backbone:pET303/CT-His; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:33:48 0
MBP-GFP-RGG
 
Resource Report
Resource Website
RRID:Addgene_242453 MBP-GFP-RGG Caenorhabditis elegans Kanamycin PMID:34916288 The depositor confirms that discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences. Backbone Size:5210; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:33:50 0
GST-GFP-RGG
 
Resource Report
Resource Website
RRID:Addgene_242454 GST-GFP-RGG Caenorhabditis elegans Kanamycin PMID:34916288 The depositor confirms that discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences. Backbone Size:5210; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:33:51 0
MBP-Streptavidin-RGG
 
Resource Report
Resource Website
RRID:Addgene_242451 MBP-Streptavidin-RGG (using LAF-1 RGG domain) Caenorhabditis elegans Kanamycin PMID:40229261 The depositor confirms that discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences. Backbone Size:4208; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:33:51 0
pBD30
 
Resource Report
Resource Website
RRID:Addgene_245767 rap-1::mCherry Caenorhabditis elegans Ampicillin PMID:40748210 Vector Backbone:pDEST; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:34:03 0
pBD28
 
Resource Report
Resource Website
RRID:Addgene_245766 tiam-1::mGFP Caenorhabditis elegans Spectinomycin PMID:40748210 Vector Backbone:pCR8/GW/TOPO; Vector Types:Unspecified; Bacterial Resistance:Spectinomycin 2026-08-15 01:34:01 0
pREA16
 
Resource Report
Resource Website
RRID:Addgene_245771 mCherry::RBD::T2A::rac-2::mGFP Caenorhabditis elegans Ampicillin PMID:40748210 Vector Backbone:pDEST; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:34:01 0
pREA12
 
Resource Report
Resource Website
RRID:Addgene_245770 mCherry::RBD::T2A::rac-2::mGFP Caenorhabditis elegans Spectinomycin PMID:40748210 Vector Backbone:pCR8/GW/TOPO; Vector Types:Unspecified; Bacterial Resistance:Spectinomycin 2026-08-15 01:34:03 0
pSJC319
 
Resource Report
Resource Website
RRID:Addgene_245775 rap-1(G12V)::mGFP Caenorhabditis elegans Ampicillin PMID:40748210 Vector Backbone:pDEST; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin G12V 2026-08-15 01:34:01 0
pSJC318
 
Resource Report
Resource Website
RRID:Addgene_245774 rac-2(G12V)::mGFP Caenorhabditis elegans Spectinomycin PMID:40748210 Vector Backbone:pCR8/GW/TOPO; Vector Types:Unspecified; Bacterial Resistance:Spectinomycin G12V 2026-08-15 01:34:01 0
pSJC321
 
Resource Report
Resource Website
RRID:Addgene_245777 rac-2(G12V)::mGFP Caenorhabditis elegans Ampicillin PMID:40748210 Vector Backbone:pDEST; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin G12V 2026-08-15 01:34:01 0
Ce iPGM-C-HiBiT
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_207120 C. elegans-iPGM HiBIT His10 Caenorhabditis elegans Ampicillin PMID:40346061 Backbone Marker:EMD Biosciences (Novagen); Backbone Size:5443; Vector Backbone:pET21a (+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Codon optmization for expression in BL21DE3 2026-08-15 01:32:50 1
pCI_AFF-1-FLAG_H2B-RFP
 
Resource Report
Resource Website
RRID:Addgene_240506 AFF-1 Caenorhabditis elegans Ampicillin PMID:35794124 Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:33:35 0
pcDNA 3.3 N-MYC pdzd-8
 
Resource Report
Resource Website
RRID:Addgene_227844 pdzd-8 Caenorhabditis elegans Ampicillin PMID:38898113 Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:33:09 0
pcDNA 3.3 C-MYC pdzd-8(536A)
 
Resource Report
Resource Website
RRID:Addgene_227885 pdzd-8 Caenorhabditis elegans Ampicillin PMID:38898113 Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S536A 2026-08-15 01:33:18 0
pREA2
 
Resource Report
Resource Website
RRID:Addgene_245831 rac-2 Caenorhabditis elegans Ampicillin PMID:40748210 Vector Backbone:pDEST; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:34:16 0
pREA3
 
Resource Report
Resource Website
RRID:Addgene_245832 rac-2(G12V) Caenorhabditis elegans Ampicillin PMID:40748210 Vector Backbone:pDEST; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin G12V 2026-08-15 01:34:16 0
pDV06 [punc-17::SNG-1::CRY2(535)]
 
Resource Report
Resource Website
RRID:Addgene_197597 Synaptogyrin-CRY2 (E490G + residues 1-535) Caenorhabditis elegans Ampicillin PMID:36535932 Backbone Marker:J. Rand; Vector Backbone:RM#348p; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin E490G 2026-08-15 01:28:26 0
pSAH66 - [BAGp | gfp | tbb-2 UTR]
 
Resource Report
Resource Website
RRID:Addgene_200340 [BAGp | gfp | tbb-2 UTR] Caenorhabditis elegans Ampicillin See www.wormbuilder.org/BioParts for more information. Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:28:29 0
pZCS41 (U6p::GCGAAGTGACGGTAGACCGT)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_193050 Guide RNA Caenorhabditis elegans Ampicillin PMID:37401921 Please visit https://www.biorxiv.org/content/10.1101/2022.10.30.514301v1 for bioRxiv preprint. Backbone Marker:Phillips Lab; Backbone Size:3233; Vector Backbone:pZCS11; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:27:49 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.