Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Authority:addgene (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

179,140 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pCR4-huNFATc1nuc
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_23988 NFATc1 Homo sapiens Ampicillin PMID:16740479 The c1nuc plasmid expresses the constitutively nuclear form of NFATc1 (Ho et al Nature 2004). It contains mutations in the phosphorylation sites for Dyrk1a and GSK3 that are responsible for actively exporting the protein from the nucleus (Beal et al Science 1997; Arron et al Nature 2006). It can be used as a transgene to explore NFAT signaling (Winslow et al Dev Cell 2006) and when expressed in a specific tissue can direct events such as bone development, thymocyte development or pancreatic beta cell functions (Heit J et al Nature 2007). Backbone Size:4000; Vector Backbone:pCR4; Vector Types:cloning vector; Bacterial Resistance:Ampicillin S172A S175A S176A S178A S179A S181A S184A S187A S188A S191A S194A S199A S203A S207A S211A S233A S237A S278A S282A S286A S290A 2026-09-19 02:16:02 3
RPL25-GFP (94)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_24037 RPL25 Saccharomyces cerevisiae Ampicillin Entire RPL25 ORF inserted upstream of eGFP in EcoRI/HindIII of yEGFP3 Backbone Size:5000; Vector Backbone:yEGFP3; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:16:03 2
pMOTag43M-crelox-PUR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_24032 Ampicillin pMOTag43M-crelox-PUR made by Jenny Li taking the HindIII-BamHI crelox-PUR fragment from pyrFEKO-PUR and inserting into HindIII-BamHI digested pMOTag43M. Based on pMOTag series made in pBluescript II KS+ Backbone Size:5099; Vector Backbone:pMOTag; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin 2026-09-19 02:16:03 1
pMOTag4HM-crelox-PUR
 
Resource Report
Resource Website 		RRID:Addgene_24030 Ampicillin pMOTag4HM-crelox-PUR made by Jenny Li taking the HindIII-BamHI crelox-PUR fragment from pyrFEKO-PUR and inserting into HindIII-BamHI digested pMOTag4HM made by Jessica. Backbone Size:5188; Vector Backbone:pMOTag; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin 2026-09-19 02:16:03 0
pLEW13
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_24007 T7 RNA Polymerase Ampicillin T7 RNA Polymerase and Tet Repressor present (see map). Target locus: Tubulin Regulation: None Backbone Size:6000; Vector Backbone:N/A; Vector Types:Trypanosome Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:16:02 1
pSIN ReP5-GFP-GluR1
 
Resource Report
Resource Website 		RRID:Addgene_24004 GluR1 Rattus norvegicus Ampicillin PMID:19543281 Backbone Size:7000; Vector Backbone:pSIN; Vector Types:Sindbis virus production; Bacterial Resistance:Ampicillin 2026-09-19 02:16:02 0
pFLAG ARMS
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_24086 ARMS Rattus norvegicus Ampicillin PMID:11150334 pFLAG-ARMS was generated by ligating two fragments of ARMS- HindIII/KpnI and KpnI/SpeI-- into the HindIII and XbaI sites of pFLAG. The HindIII site was generated by PCR;note that the SpeI and Xba I sites no longer exist after the ligation. Backbone Size:4700; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:16:03 1
pcDNA TrkB
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_24088 TrkB Rattus norvegicus Ampicillin PMID:11157096 Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin R133I 2026-09-19 02:16:03 3
p3667 pCMV4-E2(16) E39A
 
Resource Report
Resource Website 		RRID:Addgene_24121 HPV16 E2 E39A HPV Ampicillin PMID:16611886 Backbone Size:4874; Vector Backbone:pCMV4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin E39A 2026-09-19 02:16:03 0
pcDNA TrkC
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_24089 TrkC Rattus norvegicus Ampicillin PMID:11157096 Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:16:03 1
p3670 pCMV4-E2(16) I73A
 
Resource Report
Resource Website 		RRID:Addgene_24122 HPV16 E2 I73A HPV Ampicillin PMID:16611886 Backbone Size:4874; Vector Backbone:pCMV4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin I73A 2026-09-19 02:16:03 0
pET28 Set9 mutant
 
Resource Report
Resource Website 		RRID:Addgene_24083 Set9 Homo sapiens Kanamycin PMID:11850410 Backbone Size:5400; Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin H297A 2026-09-19 02:16:03 0
pHD309-HYG-PUR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_24014 Ampicillin Targeting: B-Tubulin Regulation: None For more information see George Cross's website: http://tryps.rockefeller.edu/trypsru2_plasmids.html Backbone Marker:George Cross; Backbone Size:6145; Vector Backbone:pHD309-HYG; Vector Types:; Bacterial Resistance:Ampicillin 2026-09-19 02:16:02 2
pJEL061
 
Resource Report
Resource Website 		RRID:Addgene_24016 Ampicillin Target locus: rRNA spacer Regulation: 1 tet Op 2 T7 terminators For additional information see George Cross's website at http://tryps.rockefeller.edu/trypsru2_plasmids.html Backbone Marker:George Cross; Backbone Size:5000; Vector Backbone:pLEW82; Vector Types:Trypanosome Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:16:02 0
pLEW111-BSD-(pFlan1)
 
Resource Report
Resource Website 		RRID:Addgene_24010 Ampicillin pLEW111 (pLEW82) with BSD instead of BLE. Target locus: rRNA spacer Regulation: 1 tet Op 2 T7 terminators Backbone Size:4662; Vector Backbone:pLEW111; Vector Types:Trypanosome Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:16:02 0
pLEW100v5
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_24011 Luciferase Ampicillin T7 terminators added: regulated rRNAp drives luciferase, giving about 10-fold higher te-induced expression in BF than pLEW100 with no increase in background. Target locus: rRNA spacer Regulation: 2 tet Op 2 T7 terminators Backbone Size:5000; Vector Backbone:pLEW100; Vector Types:Trypanosome Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:16:02 4
TrkA-RFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_24093 TrkA Rattus norvegicus Kanamycin Backbone Size:5000; Vector Backbone:pDSRed2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin H7L, G21S, V23M, C32S, T39V 2026-09-19 02:16:03 4
TrkC-GFP
 
Resource Report
Resource Website 		RRID:Addgene_24094 TrkC Rattus norvegicus Ampicillin Backbone Size:4000; Vector Backbone:pEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:16:03 0
shRNA GR
 
Resource Report
Resource Website 		RRID:Addgene_24095 Glucocorticoid Receptor Rattus norvegicus Ampicillin PMID:18347336 We designed an shRNA targeting the rat GR sequence in the pLentiLox3.7 (ATCC) plasmid carrying a GFP reporter: forward sequence, 5′-tgcgggagaagatgatccattcttcaagagagaatggatcatcttctcccgcttttttgaattc; reverse sequence, 5′-tcgagaattcaaaaaagcgggagaagatgatccattctctcttgaagaatggatcatcttctcccgca. Backbone Size:7650; Vector Backbone:pLentiLox 3.7; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-09-19 02:16:03 0
MIGR-RORgt
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_24069 Rorgt Mus musculus Ampicillin Backbone Size:6000; Vector Backbone:pMIGR; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-09-19 02:16:03 9

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

NIDDK Early Research Partnership Engagement Challenge

Funding Opportunity: National NIH K12 DiabDocs Career Development Program

NIH Data Sharing and Reuse Seminar- Sex Differences in Acute Kidney Injury Risk and Outcomes: Insights from MIMIC-III and MIMIC-IV

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch