Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: E. coli
Genetic Insert: IS621 Helper (WT)
Vector Backbone Description: Vector Backbone:pNP1950 - p15A Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38926615
Comments: Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint.
Proper citation: RRID:Addgene_222732 Copy
Species: E. coli
Genetic Insert: IS621 bridge RNA
Vector Backbone Description: Vector Backbone:pNP1723 - ColE1 Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38926615
Comments: Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint.
Proper citation: RRID:Addgene_222730 Copy
Species: E. coli
Genetic Insert: Genotype: F’[traD36 lacIq lacZ ∆M15 proA+B+] glnV (supE) thi-1 ∆(mcrB-hsdSM)5 (rK- mK- McrB-) ∆(lac-proAB) ulaD::M13
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:38499480
Comments: Primers for validation
Pair 1: agtaaggacgcgccatgaaa + agcgaaagacagcatcggaa (Ta = 59 C, should have 2526 bp product)
Pair 2: aatcggttgaatgtcgccct + gggaaacgacgatgagcaga (Ta = 59, should have 3900 bp product)
Proper citation: RRID:Addgene_220921 Copy
Species: E. coli
Genetic Insert: AsnRS
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.
Proper citation: RRID:Addgene_224363 Copy
Species: E. coli
Genetic Insert: PheRS
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.
Proper citation: RRID:Addgene_224364 Copy
Species: E. coli
Genetic Insert: IF2
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.
Proper citation: RRID:Addgene_224367 Copy
Species: E. coli
Genetic Insert: NDK
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.
Proper citation: RRID:Addgene_224376 Copy
Species: E. coli
Genetic Insert: RRF
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.
Proper citation: RRID:Addgene_224374 Copy
Species: E. coli
Genetic Insert: RF1
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.
Proper citation: RRID:Addgene_224372 Copy
Species: E. coli
Genetic Insert: EF-Tu
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.
Proper citation: RRID:Addgene_224370 Copy
Species: E. Coli
Genetic Insert: Ptn5_[Tn5]
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Proper citation: RRID:Addgene_225785 Copy
Species: E. coli
Genetic Insert: tnsABCD
Vector Backbone Description: Vector Backbone:pIND4; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:39324814
Comments: Needs to be grown in E. coli BW25141 (pir+ strain with an anti-CRISPR protein on the chromosome)
Please visit https://pubmed.ncbi.nlm.nih.gov/37662258/ for bioRxiv preprint.
Proper citation: RRID:Addgene_220900 Copy
Species: E. coli
Genetic Insert: L3S3P11
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:41581077
Comments: Type 4 pasts are terminators in the CTK system
Please note: This plasmid contains a C nucleotide insertion in L3S3P11. This insertion is not known to impact plasmid function.
Proper citation: RRID:Addgene_248472 Copy
Species: E. coli
Genetic Insert: TurboID
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Addgene NGS finds the 3x-FLAG tag C-terminal on the insert.
Proper citation: RRID:Addgene_236117 Copy
Species: E. coli
Genetic Insert: Chloramphenicol acetyl transferase fusion protein
Vector Backbone Description: Vector Backbone:CCLMPC; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40536430
Proper citation: RRID:Addgene_237500 Copy
Species: E. coli
Genetic Insert: T7-proOmpA-pep99
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: Please visit https://doi.org/10.64898/2025.12.09.688994 for bioRxiv preprint.
Proper citation: RRID:Addgene_250510 Copy
Species: E. coli
Genetic Insert: T7-secY(I408G)EG
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: Please visit https://doi.org/10.64898/2025.12.09.688994 for bioRxiv preprint.
Proper citation: RRID:Addgene_250516 Copy
Species: E. coli
Genetic Insert: T7-secYEG
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: Please visit https://doi.org/10.64898/2025.12.09.688994 for bioRxiv preprint.
Proper citation: RRID:Addgene_250513 Copy
Species: E. coli
Genetic Insert: T7-secY(P84L)EG
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: Please visit https://doi.org/10.64898/2025.12.09.688994 for bioRxiv preprint.
Proper citation: RRID:Addgene_250512 Copy
Species: E. coli
Genetic Insert: argX, glyT, leuW, proL, argU, and ileX
Vector Backbone Description: Backbone Size:3924; Vector Backbone:pSEVA121; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:42014348
Proper citation: RRID:Addgene_247474 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.