Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 37 showing 721 ~ 740 out of 1,737 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_222732

http://www.addgene.org/222732

Species: E. coli
Genetic Insert: IS621 Helper (WT)
Vector Backbone Description: Vector Backbone:pNP1950 - p15A Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38926615
Comments: Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint.

Proper citation: RRID:Addgene_222732 Copy   


  • RRID:Addgene_222730

http://www.addgene.org/222730

Species: E. coli
Genetic Insert: IS621 bridge RNA
Vector Backbone Description: Vector Backbone:pNP1723 - ColE1 Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38926615
Comments: Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint.

Proper citation: RRID:Addgene_222730 Copy   


  • RRID:Addgene_220921

http://www.addgene.org/220921

Species: E. coli
Genetic Insert: Genotype: F’[traD36 lacIq lacZ ∆M15 proA+B+] glnV (supE) thi-1 ∆(mcrB-hsdSM)5 (rK- mK- McrB-) ∆(lac-proAB) ulaD::M13
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:38499480
Comments: Primers for validation Pair 1: agtaaggacgcgccatgaaa + agcgaaagacagcatcggaa (Ta = 59 C, should have 2526 bp product) Pair 2: aatcggttgaatgtcgccct + gggaaacgacgatgagcaga (Ta = 59, should have 3900 bp product)

Proper citation: RRID:Addgene_220921 Copy   


  • RRID:Addgene_224363

http://www.addgene.org/224363

Species: E. coli
Genetic Insert: AsnRS
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.

Proper citation: RRID:Addgene_224363 Copy   


http://www.addgene.org/224364

Species: E. coli
Genetic Insert: PheRS
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.

Proper citation: RRID:Addgene_224364 Copy   


  • RRID:Addgene_224367

http://www.addgene.org/224367

Species: E. coli
Genetic Insert: IF2
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.

Proper citation: RRID:Addgene_224367 Copy   


  • RRID:Addgene_224376

http://www.addgene.org/224376

Species: E. coli
Genetic Insert: NDK
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.

Proper citation: RRID:Addgene_224376 Copy   


  • RRID:Addgene_224374

http://www.addgene.org/224374

Species: E. coli
Genetic Insert: RRF
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.

Proper citation: RRID:Addgene_224374 Copy   


  • RRID:Addgene_224372

http://www.addgene.org/224372

Species: E. coli
Genetic Insert: RF1
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.

Proper citation: RRID:Addgene_224372 Copy   


  • RRID:Addgene_224370

http://www.addgene.org/224370

Species: E. coli
Genetic Insert: EF-Tu
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40209036
Comments: It is best to grow cells in strains with LacIq and in media supplemented 1% glucose for genetic stability. Please visit https://doi.org/10.1101/2024.06.19.599772 for bioRxiv preprint.

Proper citation: RRID:Addgene_224370 Copy   


  • RRID:Addgene_225785

http://www.addgene.org/225785

Species: E. Coli
Genetic Insert: Ptn5_[Tn5]
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol

Proper citation: RRID:Addgene_225785 Copy   


  • RRID:Addgene_220900

http://www.addgene.org/220900

Species: E. coli
Genetic Insert: tnsABCD
Vector Backbone Description: Vector Backbone:pIND4; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:39324814
Comments: Needs to be grown in E. coli BW25141 (pir+ strain with an anti-CRISPR protein on the chromosome) Please visit https://pubmed.ncbi.nlm.nih.gov/37662258/ for bioRxiv preprint.

Proper citation: RRID:Addgene_220900 Copy   


  • RRID:Addgene_248472

http://www.addgene.org/248472

Species: E. coli
Genetic Insert: L3S3P11
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:41581077
Comments: Type 4 pasts are terminators in the CTK system Please note: This plasmid contains a C nucleotide insertion in L3S3P11. This insertion is not known to impact plasmid function.

Proper citation: RRID:Addgene_248472 Copy   


  • RRID:Addgene_236117

http://www.addgene.org/236117

Species: E. coli
Genetic Insert: TurboID
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Addgene NGS finds the 3x-FLAG tag C-terminal on the insert.

Proper citation: RRID:Addgene_236117 Copy   


  • RRID:Addgene_237500

http://www.addgene.org/237500

Species: E. coli
Genetic Insert: Chloramphenicol acetyl transferase fusion protein
Vector Backbone Description: Vector Backbone:CCLMPC; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40536430

Proper citation: RRID:Addgene_237500 Copy   


  • RRID:Addgene_250510

http://www.addgene.org/250510

Species: E. coli
Genetic Insert: T7-proOmpA-pep99
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: Please visit https://doi.org/10.64898/2025.12.09.688994 for bioRxiv preprint.

Proper citation: RRID:Addgene_250510 Copy   


  • RRID:Addgene_250516

http://www.addgene.org/250516

Species: E. coli
Genetic Insert: T7-secY(I408G)EG
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: Please visit https://doi.org/10.64898/2025.12.09.688994 for bioRxiv preprint.

Proper citation: RRID:Addgene_250516 Copy   


  • RRID:Addgene_250513

http://www.addgene.org/250513

Species: E. coli
Genetic Insert: T7-secYEG
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: Please visit https://doi.org/10.64898/2025.12.09.688994 for bioRxiv preprint.

Proper citation: RRID:Addgene_250513 Copy   


  • RRID:Addgene_250512

http://www.addgene.org/250512

Species: E. coli
Genetic Insert: T7-secY(P84L)EG
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: Please visit https://doi.org/10.64898/2025.12.09.688994 for bioRxiv preprint.

Proper citation: RRID:Addgene_250512 Copy   


  • RRID:Addgene_247474

http://www.addgene.org/247474

Species: E. coli
Genetic Insert: argX, glyT, leuW, proL, argU, and ileX
Vector Backbone Description: Backbone Size:3924; Vector Backbone:pSEVA121; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:42014348

Proper citation: RRID:Addgene_247474 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X