Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:caenorhabditis elegans (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

1,881 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pSAH66 - [BAGp | gfp | tbb-2 UTR]
 
Resource Report
Resource Website 		RRID:Addgene_200340 [BAGp | gfp | tbb-2 UTR] Caenorhabditis elegans Ampicillin See www.wormbuilder.org/BioParts for more information. Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:28:29 0
pJR017
 
Resource Report
Resource Website 		RRID:Addgene_198835 15xUAS::TeTX-SL2-mKate::let-858 3'UTR Caenorhabditis elegans Ampicillin PMID:38096407 Backbone Marker:Fire Lab C. elegans Vector Kit; Vector Backbone:pPD117.01; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:27:17 0
pSF11-wmCardinal-T2A-HO1
 
Resource Report
Resource Website 		RRID:Addgene_197249 wmCardinal-T2A-HO1 Caenorhabditis elegans Ampicillin PMID:37666982 Please visit https://www.researchsquare.com/article/rs-797586/v1 for preprint. Vector Backbone:pSF11; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:27:20 0
pSF11-wmiRFP720-T2A-HO1
 
Resource Report
Resource Website 		RRID:Addgene_197248 wmiRFP720-T2A-HO1 Caenorhabditis elegans Ampicillin PMID:37666982 Please visit https://www.researchsquare.com/article/rs-797586/v1 for preprint. Vector Backbone:pSF11; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:27:20 0
pSF11-wmNeonGreen
 
Resource Report
Resource Website 		RRID:Addgene_197242 wmNeonGreen Caenorhabditis elegans Ampicillin PMID:37666982 Please visit https://www.researchsquare.com/article/rs-797586/v1 for preprint. Vector Backbone:pN1; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:27:20 0
pHIT517
 
Resource Report
Resource Website 		RRID:Addgene_204518 cec-4 (C. elegans) Caenorhabditis elegans Kanamycin PMID:37078421 Backbone Size:6442; Vector Backbone:pHIT198 (derived from pET-28a); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:27:25 0
pHIT334
 
Resource Report
Resource Website 		RRID:Addgene_204516 C-terminal fragment of coh-3 (C. elegans) Caenorhabditis elegans Kanamycin PMID:37078421 Backbone Size:6442; Vector Backbone:pHIT198 (derived from pET-28a); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:27:23 0
pHIT320
 
Resource Report
Resource Website 		RRID:Addgene_204517 Internal fragment of him-1 (C. elegans) Caenorhabditis elegans Kanamycin PMID:37078421 Backbone Size:6442; Vector Backbone:pHIT198 (derived from pET-28a); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:27:23 0
pHIT239
 
Resource Report
Resource Website 		RRID:Addgene_204522 Mos1_transposase::glh-2_3'UTR Caenorhabditis elegans Ampicillin PMID:37078421 T7p, SL1, StuI, Mos1 transposase, NheI, glh-2 3’UTR, XbaI, a 61-nt poly(A), BsaI and SpeI; linearize with BsaI and use for in vitro transcription of mRNA Backbone Size:3073; Vector Backbone:pHIT88 (derived from pCITE-4b); Vector Types:Other; Bacterial Resistance:Ampicillin 2026-08-15 01:27:23 0
pCCM937
 
Resource Report
Resource Website 		RRID:Addgene_58982 avr-15 sgRNA Caenorhabditis elegans Kanamycin PMID:24879462 gRNA target sequence GTTTGCAATATAAGTCACCC Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:17:20 0
pCCM936
 
Resource Report
Resource Website 		RRID:Addgene_58981 avr-14 sgRNA Caenorhabditis elegans Kanamycin PMID:24879462 gRNA target sequence GATTGGAGAGTTAGACCACG Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:17:20 0
B1979
 
Resource Report
Resource Website 		RRID:Addgene_59181 Blasticidin S resistance Caenorhabditis elegans Ampicillin PMID:24879462 Backbone Marker:Addgene; Backbone Size:1961; Vector Backbone:pBluescript KS(+); Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:21 0
pDD401
 
Resource Report
Resource Website 		RRID:Addgene_91828 Pmyo-2::GFP Caenorhabditis elegans Kanamycin PMID:32550377 The Pmyo-2::GFP cassette is inserted in place of a fluorescent protein in the assembled repair template. This is intended for knocking out a gene and replacing it with Pmyo-2::GFP. Vector Backbone:pDONR221; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin Nucleotide 489 of the myo-2 promoter was changed from G to C to eliminate a SapI site 2026-08-15 01:22:24 0
CTL2 (M2225R)
 
Resource Report
Resource Website 		RRID:Addgene_96952 CTL2 (M222R) of PIEZO1 Caenorhabditis elegans Ampicillin PMID:25242456 Note: M2225R mutation refers to human mutation of gene. M2092R is mutation in C. elegans. Backbone Marker:Novagen; Backbone Size:5300; Vector Backbone:pET21b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:22:31 0
pET28-ceRab21(1-209)
 
Resource Report
Resource Website 		RRID:Addgene_59555 1-209 Caenorhabditis elegans Ampicillin PMID:20462958 Vector Backbone:pET28; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:17:23 0
pET28-ceRab2(1-214)
 
Resource Report
Resource Website 		RRID:Addgene_59550 1-214 Caenorhabditis elegans Ampicillin PMID:20462958 Vector Backbone:pET28; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:17:23 0
pET28-ceRab11(1-211)
 
Resource Report
Resource Website 		RRID:Addgene_59553 1-211 Caenorhabditis elegans Ampicillin PMID:20462958 Vector Backbone:pET28; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:17:23 0
pSA108
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_59786 cdc-42 promoter Caenorhabditis elegans Ampicillin PMID:25377555 Vector Backbone:pCFJ150; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:26 1
pSA110
 
Resource Report
Resource Website 		RRID:Addgene_59784 elt-2 promoter Caenorhabditis elegans Ampicillin PMID:25377555 Vector Backbone:pCFJ150; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:26 0
pJA59
 
Resource Report
Resource Website 		RRID:Addgene_59932 unc-109(n499) gRNA Caenorhabditis elegans Kanamycin PMID:25161212 Vector Backbone:pRB1017; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:17:27 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch