Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 36 showing 701 ~ 720 out of 4,489 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_32432

http://www.addgene.org/32432

Species: Saccharomyces cerevisiae
Genetic Insert: INP52
Vector Backbone Description: Backbone Marker:ATCC; Vector Backbone:YCplac22; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14761940
Comments: INP52 was amplified from yeast genomic DNA using 5′ PstI and 3′ BamHI site-containing oligonucleotides, digested and ligated into PstI- and BamHI-digested YCplac22. The NotI site was inserted at the 5′-end of INP52 via QuikChange™ mutagenesis. A triple HA epitope was ligated into the NotI site to generate pHA-INP52 (LHP1463).

Proper citation: RRID:Addgene_32432 Copy   


  • RRID:Addgene_32433

http://www.addgene.org/32433

Species: Saccharomyces cerevisiae
Genetic Insert: YCK2
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pFastbac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_32433 Copy   


  • RRID:Addgene_32302

http://www.addgene.org/32302

Species: Saccharomyces cerevisiae
Genetic Insert: 20XUAS
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2609; Vector Backbone:pDONR 221 P1-P5r; Vector Types:Gateway MultiSite entry vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21931740
Comments: Please see http://www.everyvector.com/sequences/show_public/12859 for additional plasmid map.

Proper citation: RRID:Addgene_32302 Copy   


  • RRID:Addgene_32309

http://www.addgene.org/32309

Species: Saccharomyces cerevisiae
Genetic Insert: GAL4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2667; Vector Backbone:pDONR 221 P4r-P3r; Vector Types:Gateway MultiSite entry clone; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21931740
Comments: Please see http://www.everyvector.com/sequences/show_public/12862 for additional plasmid map.

Proper citation: RRID:Addgene_32309 Copy   


  • RRID:Addgene_32439

http://www.addgene.org/32439

Species: Saccharomyces cerevisiae
Genetic Insert: BUL1
Vector Backbone Description: Backbone Marker:ATCC; Vector Backbone:YCplac111; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_32439 Copy   


http://www.addgene.org/33131

Species: Saccharomyces cerevisiae
Genetic Insert: RP51A+intron-LacZ
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:6308621
Comments: GAL-UAS-CYC1-TATA-C7C1-ATG-RP51A+intron-LacZ

Proper citation: RRID:Addgene_33131 Copy   


  • RRID:Addgene_33149

http://www.addgene.org/33149

Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2655924
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG

Proper citation: RRID:Addgene_33149 Copy   


  • RRID:Addgene_33148

http://www.addgene.org/33148

Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2655924
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG

Proper citation: RRID:Addgene_33148 Copy   


  • RRID:Addgene_33232

http://www.addgene.org/33232

Species: Saccharomyces cerevisiae
Genetic Insert: Rad51
Vector Backbone Description: Backbone Size:5857; Vector Backbone:pYES2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864034

Proper citation: RRID:Addgene_33232 Copy   


  • RRID:Addgene_33230

http://www.addgene.org/33230

Species: Saccharomyces cerevisiae
Genetic Insert: Rad51
Vector Backbone Description: Backbone Size:5857; Vector Backbone:pYES2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864034

Proper citation: RRID:Addgene_33230 Copy   


  • RRID:Addgene_33150

http://www.addgene.org/33150

Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2655924
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG

Proper citation: RRID:Addgene_33150 Copy   


  • RRID:Addgene_33151

http://www.addgene.org/33151

Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2655924
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG Modified intron sequence: GACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG

Proper citation: RRID:Addgene_33151 Copy   


  • RRID:Addgene_34605

http://www.addgene.org/34605

Species: Saccharomyces cerevisiae
Genetic Insert: PYK1
Vector Backbone Description: Backbone Marker:ATCC#87362 (PMID:7737504); Backbone Size:5557; Vector Backbone:P413TEF; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21907146

Proper citation: RRID:Addgene_34605 Copy   


  • RRID:Addgene_34604

http://www.addgene.org/34604

Species: Saccharomyces cerevisiae
Genetic Insert: PYK1
Vector Backbone Description: Backbone Marker:ATCC#87360 (PMID: 7737504; Backbone Size:5739; Vector Backbone:p416GPD; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21907146

Proper citation: RRID:Addgene_34604 Copy   


  • RRID:Addgene_34550

http://www.addgene.org/34550

Species: Saccharomyces cerevisiae
Genetic Insert: Ace1
Vector Backbone Description: Backbone Marker:T.S Karpova; Vector Backbone:pTSK65; Vector Types:Yeast Expression, Integrative Plasmid; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18218898

Proper citation: RRID:Addgene_34550 Copy   


  • RRID:Addgene_29383

    This resource has 1+ mentions.

http://www.addgene.org/29383

Species: Saccharomyces cerevisiae
Genetic Insert: SUP45 gene encoding translation release factor 1 from S. cerevisiae
Vector Backbone Description: Backbone Size:5976; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20444877

Proper citation: RRID:Addgene_29383 Copy   


  • RRID:Addgene_29382

http://www.addgene.org/29382

Species: Saccharomyces cerevisiae
Genetic Insert: SUP45 gene encoding translation release factor 1 from S. cerevisiae
Vector Backbone Description: Backbone Size:5976; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20444877

Proper citation: RRID:Addgene_29382 Copy   


  • RRID:Addgene_29381

http://www.addgene.org/29381

Species: Saccharomyces cerevisiae
Genetic Insert: SUP45 gene encoding translation release factor 1 from S. cerevisiae
Vector Backbone Description: Backbone Size:5976; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20444877

Proper citation: RRID:Addgene_29381 Copy   


  • RRID:Addgene_29379

http://www.addgene.org/29379

Species: Saccharomyces cerevisiae
Genetic Insert: SUP45 gene encoding translation release factor 1 from S. cerevisiae
Vector Backbone Description: Backbone Size:5976; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20444877

Proper citation: RRID:Addgene_29379 Copy   


  • RRID:Addgene_29376

http://www.addgene.org/29376

Species: Saccharomyces cerevisiae
Genetic Insert: SUP45 gene encoding translation release factor 1 from S. cerevisiae
Vector Backbone Description: Backbone Size:5976; Vector Backbone:pRS315; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20444877

Proper citation: RRID:Addgene_29376 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X