Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pTH278-GST-TEV-SUP45 Resource Report Resource Website |
RRID:Addgene_29743 | SUP45 gene encoding translation release factor 1 from S. cerevisiae | Saccharomyces cerevisiae | Ampicillin | Backbone Marker:GE Healthcare; Backbone Size:4968; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | wild type | 2026-08-29 01:03:39 | 0 | ||
|
pCSFLPe Resource Report Resource Website 1+ mentions |
RRID:Addgene_31130 | FLP recombinase | Saccharomyces cerevisiae | Ampicillin | PMID:11376165 | Backbone Size:4100; Vector Backbone:pCS2+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:03:47 | 2 | ||
|
pCY 3010-02 Resource Report Resource Website |
RRID:Addgene_36210 | yeast-enhanced (yE) polylinker | Saccharomyces cerevisiae | Ampicillin | PMID:22473760 | Backbone Marker:Yeast Resource Center, University of Washington; Backbone Size:4875; Vector Backbone:pBS10; Vector Types:Yeast cassette for PCR and homologous recombination; Bacterial Resistance:Ampicillin | 2026-08-29 01:04:28 | 0 | ||
|
pNRB65 Resource Report Resource Website |
RRID:Addgene_36455 | ARS501-LEU2 | Saccharomyces cerevisiae | Ampicillin | This plasmid is for generating dmc1Δ::LEU2 alleles by single step transplacement. See the attached map for additional details. | Backbone Size:3000; Vector Backbone:pNRB8; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:04:31 | 0 | ||
|
pJJH1308 Resource Report Resource Website |
RRID:Addgene_36911 | ScURA3 | Saccharomyces cerevisiae | Ampicillin | PMID:22327349 | Vector Backbone:L22; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:04:36 | 0 | ||
|
pJJH1338 Resource Report Resource Website |
RRID:Addgene_36912 | ScURA3 | Saccharomyces cerevisiae | Ampicillin | PMID:22327349 | Vector Backbone:L22-EGFP; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:04:35 | 0 | ||
|
pJJH1295 Resource Report Resource Website 1+ mentions |
RRID:Addgene_36914 | 3x mCherry | Saccharomyces cerevisiae | Ampicillin | PMID:22327349 | Backbone Size:9951; Vector Backbone:pSinRep5; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:04:36 | 2 | ||
|
pBJ1808 pRS416-COF1RFP Resource Report Resource Website |
RRID:Addgene_37103 | COF1-RFP | Saccharomyces cerevisiae | Ampicillin | PMID:20332110 | Vector Backbone:pRS416-URA,Amp; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Single RFP internal insertion at Cof147T48D with linker(AGAGDGAGL) at both sides. This construct contains endogenous COF1 5' 650 , intron, and 3' 250 bp. Cof1-RFP labels actin patches in yeast. | 2026-08-29 01:04:37 | 0 | |
|
pBJ1806 pRS413-COF1RFP Resource Report Resource Website |
RRID:Addgene_37101 | COF1-RFP | Saccharomyces cerevisiae | Ampicillin | PMID:20332110 | Vector Backbone:pRS413-HIS,Amp; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Single RFP internal insertion at Cof147T48D with linker(AGAGDGAGL) at both sides. This construct contains endogenous COF1 5' 650 , intron, and 3' 250 bp. Cof1-RFP labels actin patches in yeast. | 2026-08-29 01:04:38 | 0 | |
|
pET15b-eIF4E Resource Report Resource Website |
RRID:Addgene_37228 | eIF4E | Saccharomyces cerevisiae | Ampicillin | PMID:20864040 | Backbone Marker:EMD bioscience; Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:04:38 | 0 | ||
|
pET15b-eIF4E-S200C Resource Report Resource Website |
RRID:Addgene_37229 | eIF4E | Saccharomyces cerevisiae | Ampicillin | PMID:20864040 | Backbone Marker:EMD bioscience; Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | S200C | 2026-08-29 01:04:38 | 0 | |
|
pMGAHisTev5B Resource Report Resource Website |
RRID:Addgene_37221 | eIF5B | Saccharomyces cerevisiae | Kanamycin | PMID:17913637 | Vector Backbone:pSKB3; Vector Types:; Bacterial Resistance:Kanamycin | N-term truncation (contains aa 396-1002) | 2026-08-29 01:04:39 | 0 | |
|
pUC19-HHtRNA Resource Report Resource Website |
RRID:Addgene_37222 | HHtRNA | Saccharomyces cerevisiae | Ampicillin | PMID:17913637 | HHtRNA sequence (rev orientation): TGGTAGCGCCGCTCGGTTTCGATCCGAGGACATCAGGGTTATGAGCCCTGCGCGCTTCCACTGCGCCACGGCGCTGACGGTACCGGGTACCGTTTCGTCCTCACGGACTCATCAGAGCG | Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:04:38 | 0 | |
|
pTYB2-eIF1 Resource Report Resource Website |
RRID:Addgene_37217 | eIF1 | Saccharomyces cerevisiae | Ampicillin | PMID:17913637 | Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:04:39 | 0 | ||
|
pTYB2-eIF5 Resource Report Resource Website |
RRID:Addgene_37219 | eIF5 | Saccharomyces cerevisiae | Ampicillin | PMID:17913637 | Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:04:38 | 0 | ||
|
pTYB2-HCR1 Resource Report Resource Website |
RRID:Addgene_37233 | HRC1 | Saccharomyces cerevisiae | Ampicillin | PMID:20864040 | Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:04:39 | 0 | ||
|
pRS306:Met3p-mCherry-Tub1 Resource Report Resource Website |
RRID:Addgene_37554 | Met3p-mCherry-Tub1 | Saccharomyces cerevisiae | Ampicillin | PMID:21294277 | Backbone Size:4381; Vector Backbone:pRS306; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:04:42 | 0 | ||
|
pKT0128-RAS2 C-term Resource Report Resource Website |
RRID:Addgene_37557 | Ras2 C-term (last 9 aa) | Saccharomyces cerevisiae | Ampicillin | PMID:19755860 | Backbone Size:4749; Vector Backbone:pKT0128; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:04:42 | 0 | ||
|
tandem PA-GFP-KanR Resource Report Resource Website |
RRID:Addgene_37548 | tandem PA-GFP | Saccharomyces cerevisiae | Ampicillin | PMID:18727145 | Backbone Size:4882; Vector Backbone:pDH3; Vector Types:Yeast tagging; Bacterial Resistance:Ampicillin | 2026-08-29 01:04:42 | 0 | ||
|
pGADT7-ADH700-yeCherry-pTEF1(ashbya)-yeGFP-DHFR Resource Report Resource Website |
RRID:Addgene_24585 | pADH1 yeCherry::pTEF1 (Ashbya)yeGFP-DHFR | Saccharomyces cerevisiae | Ampicillin | PMID:20017217 | Backbone Size:6000; Vector Backbone:pGADT7; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 1. Truncated version of ADH700 promoter (SbfI/SpeI) driven yeast enhanced RFP (SpeI/-). 2. promoter TEF1(Ashbya.) (SacII/BglII) driven yeast enhanced GFP fused to E.coli DHFR (BglII/XhoI) | 2026-08-29 01:02:33 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.