Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:saccharomyces cerevisiae (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

4,489 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pTH278-GST-TEV-SUP45
 
Resource Report
Resource Website 		RRID:Addgene_29743 SUP45 gene encoding translation release factor 1 from S. cerevisiae Saccharomyces cerevisiae Ampicillin Backbone Marker:GE Healthcare; Backbone Size:4968; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin wild type 2026-08-29 01:03:39 0
pCSFLPe
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31130 FLP recombinase Saccharomyces cerevisiae Ampicillin PMID:11376165 Backbone Size:4100; Vector Backbone:pCS2+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:03:47 2
pCY 3010-02
 
Resource Report
Resource Website 		RRID:Addgene_36210 yeast-enhanced (yE) polylinker Saccharomyces cerevisiae Ampicillin PMID:22473760 Backbone Marker:Yeast Resource Center, University of Washington; Backbone Size:4875; Vector Backbone:pBS10; Vector Types:Yeast cassette for PCR and homologous recombination; Bacterial Resistance:Ampicillin 2026-08-29 01:04:28 0
pNRB65
 
Resource Report
Resource Website 		RRID:Addgene_36455 ARS501-LEU2 Saccharomyces cerevisiae Ampicillin This plasmid is for generating dmc1Δ::LEU2 alleles by single step transplacement. See the attached map for additional details. Backbone Size:3000; Vector Backbone:pNRB8; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:04:31 0
pJJH1308
 
Resource Report
Resource Website 		RRID:Addgene_36911 ScURA3 Saccharomyces cerevisiae Ampicillin PMID:22327349 Vector Backbone:L22; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-29 01:04:36 0
pJJH1338
 
Resource Report
Resource Website 		RRID:Addgene_36912 ScURA3 Saccharomyces cerevisiae Ampicillin PMID:22327349 Vector Backbone:L22-EGFP; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-29 01:04:35 0
pJJH1295
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_36914 3x mCherry Saccharomyces cerevisiae Ampicillin PMID:22327349 Backbone Size:9951; Vector Backbone:pSinRep5; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:04:36 2
pBJ1808 pRS416-COF1RFP
 
Resource Report
Resource Website 		RRID:Addgene_37103 COF1-RFP Saccharomyces cerevisiae Ampicillin PMID:20332110 Vector Backbone:pRS416-URA,Amp; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Single RFP internal insertion at Cof147T48D with linker(AGAGDGAGL) at both sides. This construct contains endogenous COF1 5' 650 , intron, and 3' 250 bp. Cof1-RFP labels actin patches in yeast. 2026-08-29 01:04:37 0
pBJ1806 pRS413-COF1RFP
 
Resource Report
Resource Website 		RRID:Addgene_37101 COF1-RFP Saccharomyces cerevisiae Ampicillin PMID:20332110 Vector Backbone:pRS413-HIS,Amp; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Single RFP internal insertion at Cof147T48D with linker(AGAGDGAGL) at both sides. This construct contains endogenous COF1 5' 650 , intron, and 3' 250 bp. Cof1-RFP labels actin patches in yeast. 2026-08-29 01:04:38 0
pET15b-eIF4E
 
Resource Report
Resource Website 		RRID:Addgene_37228 eIF4E Saccharomyces cerevisiae Ampicillin PMID:20864040 Backbone Marker:EMD bioscience; Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:04:38 0
pET15b-eIF4E-S200C
 
Resource Report
Resource Website 		RRID:Addgene_37229 eIF4E Saccharomyces cerevisiae Ampicillin PMID:20864040 Backbone Marker:EMD bioscience; Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin S200C 2026-08-29 01:04:38 0
pMGAHisTev5B
 
Resource Report
Resource Website 		RRID:Addgene_37221 eIF5B Saccharomyces cerevisiae Kanamycin PMID:17913637 Vector Backbone:pSKB3; Vector Types:; Bacterial Resistance:Kanamycin N-term truncation (contains aa 396-1002) 2026-08-29 01:04:39 0
pUC19-HHtRNA
 
Resource Report
Resource Website 		RRID:Addgene_37222 HHtRNA Saccharomyces cerevisiae Ampicillin PMID:17913637 HHtRNA sequence (rev orientation): TGGTAGCGCCGCTCGGTTTCGATCCGAGGACATCAGGGTTATGAGCCCTGCGCGCTTCCACTGCGCCACGGCGCTGACGGTACCGGGTACCGTTTCGTCCTCACGGACTCATCAGAGCG Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:04:38 0
pTYB2-eIF1
 
Resource Report
Resource Website 		RRID:Addgene_37217 eIF1 Saccharomyces cerevisiae Ampicillin PMID:17913637 Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:04:39 0
pTYB2-eIF5
 
Resource Report
Resource Website 		RRID:Addgene_37219 eIF5 Saccharomyces cerevisiae Ampicillin PMID:17913637 Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:04:38 0
pTYB2-HCR1
 
Resource Report
Resource Website 		RRID:Addgene_37233 HRC1 Saccharomyces cerevisiae Ampicillin PMID:20864040 Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:04:39 0
pRS306:Met3p-mCherry-Tub1
 
Resource Report
Resource Website 		RRID:Addgene_37554 Met3p-mCherry-Tub1 Saccharomyces cerevisiae Ampicillin PMID:21294277 Backbone Size:4381; Vector Backbone:pRS306; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:04:42 0
pKT0128-RAS2 C-term
 
Resource Report
Resource Website 		RRID:Addgene_37557 Ras2 C-term (last 9 aa) Saccharomyces cerevisiae Ampicillin PMID:19755860 Backbone Size:4749; Vector Backbone:pKT0128; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:04:42 0
tandem PA-GFP-KanR
 
Resource Report
Resource Website 		RRID:Addgene_37548 tandem PA-GFP Saccharomyces cerevisiae Ampicillin PMID:18727145 Backbone Size:4882; Vector Backbone:pDH3; Vector Types:Yeast tagging; Bacterial Resistance:Ampicillin 2026-08-29 01:04:42 0
pGADT7-ADH700-yeCherry-pTEF1(ashbya)-yeGFP-DHFR
 
Resource Report
Resource Website 		RRID:Addgene_24585 pADH1 yeCherry::pTEF1 (Ashbya)yeGFP-DHFR Saccharomyces cerevisiae Ampicillin PMID:20017217 Backbone Size:6000; Vector Backbone:pGADT7; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 1. Truncated version of ADH700 promoter (SbfI/SpeI) driven yeast enhanced RFP (SpeI/-). 2. promoter TEF1(Ashbya.) (SacII/BglII) driven yeast enhanced GFP fused to E.coli DHFR (BglII/XhoI) 2026-08-29 01:02:33 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch