Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: FKHR
Vector Backbone Description: Backbone Size:4968; Vector Backbone:pGEX4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_10706 Copy
Species: Synthetic
Genetic Insert: SaCas9
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Comments: LacZ sgRNA for SaCas9
Proper citation: RRID:Addgene_107049 Copy
Species: Homo sapiens
Genetic Insert: Gamma adaptin 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: diagnostic digest with BamHI and EcoRI should release 2.1kb fragment.
Proper citation: RRID:Addgene_10712 Copy
Species: Homo sapiens
Genetic Insert: FKHRL1 AAA
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pSG5L; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12150827
Proper citation: RRID:Addgene_10711 Copy
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:derived from pX552 (Addgene# 60958); Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_107023 Copy
Species: Homo sapiens
Genetic Insert: CD274
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29246442
Proper citation: RRID:Addgene_107006 Copy
Species: Homo sapiens
Genetic Insert: CD274
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29246442
Proper citation: RRID:Addgene_107004 Copy
Species: Homo sapiens
Genetic Insert: CD274
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29246442
Proper citation: RRID:Addgene_107003 Copy
Species: Mus musculus
Genetic Insert: tristetraprolin
Vector Backbone Description: Backbone Marker:Thermo Scientific; Vector Backbone:pTRIPZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29246442
Comments: Please note- Addgene's quality control found one “g” nucleotide missing from the insert sequence. The depositor noted this "g" should make no difference to the function of plasmid, since it is located within an intron and will be spliced out.
Proper citation: RRID:Addgene_107000 Copy
Species: Homo sapiens
Genetic Insert: CD274
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29246442
Proper citation: RRID:Addgene_107009 Copy
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_107055 Copy
Genetic Insert: TurboID (BirA mutant)
Vector Backbone Description: Vector Backbone:pLX304; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30125270
Comments: Please visit https://www.biorxiv.org/content/early/2017/10/02/196980 for BioRxiv preprint
Proper citation: RRID:Addgene_107175 Copy
Genetic Insert: miniTurbo (BirA mutant)
Vector Backbone Description: Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30125270
Comments: Please visit https://www.biorxiv.org/content/early/2017/10/02/196980 for BioRxiv preprint
Proper citation: RRID:Addgene_107174 Copy
Species: Homo sapiens
Genetic Insert: S100A11
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_107201 Copy
Species: Homo sapiens
Genetic Insert: p300 delta33
Vector Backbone Description: Backbone Marker:not the same as the commercial CMVb; Backbone Size:4800; Vector Backbone:CMVbeta; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: see author's map for pCMVb p300 wt for map of empty pCMVb vector.
Proper citation: RRID:Addgene_10719 Copy
Species: Homo sapiens
Genetic Insert: MARS
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: See author's map for cloning details. 2 BamHI sites in insert as well.
Proper citation: RRID:Addgene_10716 Copy
Species: Homo sapiens
Genetic Insert: HA-tagged Kras4B(G12V) and GFP
Vector Backbone Description: Backbone Size:11261; Vector Backbone:pLVET-IRES-GFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28604746
Comments: K-RasG12V PCR:ed from pLenti-PGK-KRAS4B(G12V)(Addgene #35633) and ligated as PmeI/BamHI fragment into pLVET-IRES-GFP
Proper citation: RRID:Addgene_107140 Copy
Vector Backbone Description: Backbone Marker:Derived from pLVET-tTR-KRAB by P. Aebisher/D. Trono (Addgene plasmid #11644); Backbone Size:11261; Vector Backbone:pLVET; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28604746
Comments: pLVET-GFP-tTR-KRAB vector (Addgene#11644) was modified by first removing tTR-KRAB with EcoRI then ligating IRES-GFP from pMSCV PIG (Addgene #21654) as a blunt end PCR fragment into previously generated pLVET-GFP cut with SmaI. Finally original GFP was removed with EcoRI/MluI => ends blunted and vector religated to generate pLVET-IRES-GFP.
Proper citation: RRID:Addgene_107139 Copy
Species: Mus musculus
Genetic Insert: Ezh2
Vector Backbone Description: Backbone Size:6573; Vector Backbone:MSCV-IRES-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_107146 Copy
Species: Synthetic
Genetic Insert: GFP + sgRNA for GFP
Vector Backbone Description: Vector Backbone:pXPR_047; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Comments: gRNA sequence is GGTGAACCGCATCGAGCTGA
pLKO TRC v2 library vector, Puro selection and eGFP expression.
Proper citation: RRID:Addgene_107145 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.