Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 335 showing 6681 ~ 6700 out of 742,877 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_236499

http://www.addgene.org/236499

Genetic Insert: Nb11-P2
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET32a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40899502
Comments: Please visit https://doi.org/10.1101/2025.03.01.640988 for bioRxiv preprint.

Proper citation: RRID:Addgene_236499 Copy   


  • RRID:Addgene_217491

http://www.addgene.org/217491

Species: Synthetic
Genetic Insert: gaussia luciferase
Vector Backbone Description: Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36302988

Proper citation: RRID:Addgene_217491 Copy   


  • RRID:Addgene_238906

http://www.addgene.org/238906

Species: Synthetic
Genetic Insert: twinStrep_aMFx1
Vector Backbone Description: Backbone Marker:TWIST bioscience; Vector Backbone:High Copy Chloramphenicol; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:39674781

Proper citation: RRID:Addgene_238906 Copy   


  • RRID:Addgene_223813

http://www.addgene.org/223813

Species: Synechocystis sp. PCC6803
Genetic Insert: SynPspA
Vector Backbone Description: Vector Backbone:pET50; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34166616

Proper citation: RRID:Addgene_223813 Copy   


http://www.addgene.org/223816

Species: Synechocystis sp. PCC6803
Genetic Insert: Vipp1
Vector Backbone Description: Vector Backbone:pET50; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39379528

Proper citation: RRID:Addgene_223816 Copy   


  • RRID:Addgene_223815

http://www.addgene.org/223815

Species: Synechocystis sp. PCC6803
Genetic Insert: Vipp1
Vector Backbone Description: Vector Backbone:pET50; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39379528

Proper citation: RRID:Addgene_223815 Copy   


http://www.addgene.org/238904

Species: Synthetic
Genetic Insert: twinStrep_FLAG_aMFx1
Vector Backbone Description: Backbone Marker:TWIST bioscience; Vector Backbone:High Copy Chloramphenicol; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:39674781

Proper citation: RRID:Addgene_238904 Copy   


http://www.addgene.org/238905

Species: Synthetic
Genetic Insert: twinStrep_HA_aMFx1
Vector Backbone Description: Backbone Marker:TWIST bioscience; Vector Backbone:High Copy Chloramphenicol; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:39674781
Comments: There are two twinStreps in this plasmid, and the depositor confirms that this does not affect function.

Proper citation: RRID:Addgene_238905 Copy   


http://www.addgene.org/238901

Species: Synthetic
Genetic Insert: C-term_aMFx1_noKREAEA
Vector Backbone Description: Backbone Marker:TWIST bioscience; Vector Backbone:High Copy Chloramphenicol; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:39674781

Proper citation: RRID:Addgene_238901 Copy   


  • RRID:Addgene_160297

http://www.addgene.org/160297

Species: Synthetic
Genetic Insert: sgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
Vector Backbone Description: Backbone Marker:Jamie Cate; Vector Backbone:pCAS (Addgene #60847); Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29626221

Proper citation: RRID:Addgene_160297 Copy   


http://www.addgene.org/193974

Genetic Insert: NbALFA-mNeonGreen
Vector Backbone Description: Vector Backbone:pHAGE; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_193974 Copy   


http://www.addgene.org/238370

Species: Homo sapiens
Genetic Insert: EWSR1
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pMAL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Synthetic, codon optimized for E. coli expression

Proper citation: RRID:Addgene_238370 Copy   


http://www.addgene.org/238369

Species: Homo sapiens
Genetic Insert: EWSR1
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pMAL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Synthetic, codon optimized for E. coli expression

Proper citation: RRID:Addgene_238369 Copy   


  • RRID:Addgene_250130

http://www.addgene.org/250130

Species: Mus musculus
Genetic Insert: Pdzk3 (3/4)
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28031468
Comments: UniProt ID: Q99MJ6

Proper citation: RRID:Addgene_250130 Copy   


  • RRID:Addgene_249826

http://www.addgene.org/249826

Species: Burkholderia pseudomallei 1710b
Genetic Insert: 13467_[Himar]
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol

Proper citation: RRID:Addgene_249826 Copy   


  • RRID:Addgene_249828

http://www.addgene.org/249828

Species: Burkholderia sp. 383
Genetic Insert: 13481_[Himar]
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol

Proper citation: RRID:Addgene_249828 Copy   


http://www.addgene.org/249426

Species: Homo sapiens
Genetic Insert: ALDOC
Vector Backbone Description: Vector Backbone:pcDNA 3.3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41125938

Proper citation: RRID:Addgene_249426 Copy   


  • RRID:Addgene_249822

http://www.addgene.org/249822

Species: Burkholderia sp. 383
Genetic Insert: 13481_[abr]
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol

Proper citation: RRID:Addgene_249822 Copy   


  • RRID:Addgene_249821

http://www.addgene.org/249821

Species: Bacillus anthracis
Genetic Insert: 14143_[abr]
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol

Proper citation: RRID:Addgene_249821 Copy   


  • RRID:Addgene_249823

http://www.addgene.org/249823

Species: Burkholderia pseudomallei 1710b
Genetic Insert: 13467_[Tn5]
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol

Proper citation: RRID:Addgene_249823 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X