Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Organism:synthetic (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

30,421 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
CMV-ER-LAR-GECO1
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_61244 LAR-GECO1 Synthetic Ampicillin PMID:25164254 The construct is numbered based on GCaMP. Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Substitutions relative to R-GECO1: V51W/I113V/N356S/D363Y/D381Y/F395A/V411A/L415I 2026-08-15 01:17:40 17
pBS-KS-attB1-2-PT-SA-SD-2-2xTY1-V5
 
Resource Report
Resource Website
RRID:Addgene_61257 2xTY1-V5 Synthetic Ampicillin PMID:25324299 Backbone Marker:Hugo J Bellen; Backbone Size:3300; Vector Backbone:pBS-KS-attB1-2-PT-SA-SD; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:17:40 0
pBS-KS-attB1-2-PT-SA-SD-1-2xTY1-V5
 
Resource Report
Resource Website
RRID:Addgene_61256 2xTY1-V5 Synthetic Ampicillin PMID:25324299 Backbone Marker:Hugo J Bellen; Backbone Size:3300; Vector Backbone:pBS-KS-attB1-2-PT-SA-SD; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:17:40 0
pJW1219
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61250 sgRNA(F+E) Synthetic Ampicillin PMID:25491644 target sequence: ggatggatgtgtagtcaatt Backbone Marker:Goldstein lab; Backbone Size:8113; Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:17:40 5
pCaSpeR-act5cB-GAL4QF
 
Resource Report
Resource Website
RRID:Addgene_61309 GAL4_DBD::QF2w_AD Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Vector Backbone:pCaSpeR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin Changed EK on C-terminus of QF2 to KKKK 2026-08-15 01:17:40 0
pQF2wWB
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61313 QF2w Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Vector Backbone:pGAWB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:40 2
pCaSpeR-act5cB-LexAQFw
 
Resource Report
Resource Website
RRID:Addgene_61311 LexA_DBD::QF2w_AD Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Vector Backbone:pCaSpeR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin Changed EK on C-terminus of QF2 to KKKK 2026-08-15 01:17:41 0
pCaSpeR-act5cB-LexAQF
 
Resource Report
Resource Website
RRID:Addgene_61310 LexA_DBD::QF2_AD Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Vector Backbone:pCaSpeR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:40 0
pDN77
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61347 mCherry Synthetic Ampicillin PMID:25019686 Please note that the mammalian selection marker in the vector backbone for this plasmid has not been verified by sequencing. Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:41 4
pDN43
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61346 mCherry Synthetic Ampicillin PMID:25019686 Please note that the mammalian selection marker in the vector backbone for this plasmid has not been verified by sequencing. Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:41 1
pDN42
 
Resource Report
Resource Website
RRID:Addgene_61345 mCherry Synthetic Ampicillin PMID:25019686 Please note that the mammalian selection marker in the vector backbone for this plasmid has not been verified by sequencing. Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:41 0
pDN41
 
Resource Report
Resource Website
RRID:Addgene_61344 mCherry Synthetic Ampicillin PMID:25019686 Please note that the mammalian selection marker in the vector backbone for this plasmid has not been verified by sequencing. Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:41 0
pDB22
 
Resource Report
Resource Website
RRID:Addgene_61342 mCherry Synthetic Ampicillin PMID:25019686 Please note that the mammalian selection marker in the vector backbone for this plasmid has not been verified by sequencing. Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:41 0
pcDNA-dCas9-HA
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61355 S.pyogenes dCas9 with c-terminal HA tag Synthetic Ampicillin PMID:25849900 Backbone Marker:Invitrogen; Life Technologies; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin D10A; H840A in S.pyogenes Cas9 2026-08-15 01:17:41 7
lenti dCAS-VP64_Blast
 
Resource Report
Resource Website
100+ mentions
RRID:Addgene_61425 dCAS9(D10A, N863A)-VP64_2A_Blast Synthetic Ampicillin PMID:25494202 IMPORTANT NOTE: If you intend to order the SAM library, this plasmid will come included with that order. Please do NOT order this plasmid if you are already planning to order the SAM library. For additional information, protocols and an activator sgRNA design tool, visit our website: http://sam.genome-engineering.org/ Vector Backbone:plenti; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin D10A and N863A in Cas9 2026-08-15 01:17:42 234
pCS2-Cer.zf1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61389 Cer.zf1 Synthetic Ampicillin PMID:25628360 Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Zebrafish expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:41 1
pCS2-Tol1.zf1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61388 tol1.zf1 Synthetic Ampicillin PMID:25628360 Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Zebrafish expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:41 7
dCAS9-VP64_GFP
 
Resource Report
Resource Website
50+ mentions
RRID:Addgene_61422 dCAS9(D10A,H840A)-VP64_2A_GFP Synthetic Ampicillin PMID:25494202 For additional information, protocols and an activator sgRNA design tool, visit our website: http://sam.genome-engineering.org/ Vector Backbone:lenti(AMP); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin D10A and H840A in Cas9 2026-08-15 01:17:42 80
pCS2-TagRFPT.zf1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61390 TagRFPT.zf1 Synthetic Ampicillin PMID:25628360 Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Zebrafish expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:42 6
pCS2-Gal4ff.zf1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61392 Gal4ff.zf1 Synthetic Ampicillin PMID:25628360 Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Zebrafish expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:41 2

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.