Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 32 showing 621 ~ 640 out of 30,421 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_61244

    This resource has 10+ mentions.

http://www.addgene.org/61244

Species: Synthetic
Genetic Insert: LAR-GECO1
Vector Backbone Description: Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25164254
Comments: The construct is numbered based on GCaMP.

Proper citation: RRID:Addgene_61244 Copy   


http://www.addgene.org/61257

Species: Synthetic
Genetic Insert: 2xTY1-V5
Vector Backbone Description: Backbone Marker:Hugo J Bellen; Backbone Size:3300; Vector Backbone:pBS-KS-attB1-2-PT-SA-SD; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25324299

Proper citation: RRID:Addgene_61257 Copy   


http://www.addgene.org/61256

Species: Synthetic
Genetic Insert: 2xTY1-V5
Vector Backbone Description: Backbone Marker:Hugo J Bellen; Backbone Size:3300; Vector Backbone:pBS-KS-attB1-2-PT-SA-SD; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25324299

Proper citation: RRID:Addgene_61256 Copy   


  • RRID:Addgene_61250

    This resource has 1+ mentions.

http://www.addgene.org/61250

Species: Synthetic
Genetic Insert: sgRNA(F+E)
Vector Backbone Description: Backbone Marker:Goldstein lab; Backbone Size:8113; Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25491644
Comments: target sequence: ggatggatgtgtagtcaatt

Proper citation: RRID:Addgene_61250 Copy   


http://www.addgene.org/61309

Species: Synthetic
Genetic Insert: GAL4_DBD::QF2w_AD
Vector Backbone Description: Vector Backbone:pCaSpeR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

Proper citation: RRID:Addgene_61309 Copy   


  • RRID:Addgene_61313

    This resource has 1+ mentions.

http://www.addgene.org/61313

Species: Synthetic
Genetic Insert: QF2w
Vector Backbone Description: Vector Backbone:pGAWB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

Proper citation: RRID:Addgene_61313 Copy   


http://www.addgene.org/61311

Species: Synthetic
Genetic Insert: LexA_DBD::QF2w_AD
Vector Backbone Description: Vector Backbone:pCaSpeR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

Proper citation: RRID:Addgene_61311 Copy   


http://www.addgene.org/61310

Species: Synthetic
Genetic Insert: LexA_DBD::QF2_AD
Vector Backbone Description: Vector Backbone:pCaSpeR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

Proper citation: RRID:Addgene_61310 Copy   


  • RRID:Addgene_61347

    This resource has 1+ mentions.

http://www.addgene.org/61347

Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25019686
Comments: Please note that the mammalian selection marker in the vector backbone for this plasmid has not been verified by sequencing.

Proper citation: RRID:Addgene_61347 Copy   


  • RRID:Addgene_61346

    This resource has 1+ mentions.

http://www.addgene.org/61346

Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25019686
Comments: Please note that the mammalian selection marker in the vector backbone for this plasmid has not been verified by sequencing.

Proper citation: RRID:Addgene_61346 Copy   


  • RRID:Addgene_61345

http://www.addgene.org/61345

Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25019686
Comments: Please note that the mammalian selection marker in the vector backbone for this plasmid has not been verified by sequencing.

Proper citation: RRID:Addgene_61345 Copy   


  • RRID:Addgene_61344

http://www.addgene.org/61344

Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25019686
Comments: Please note that the mammalian selection marker in the vector backbone for this plasmid has not been verified by sequencing.

Proper citation: RRID:Addgene_61344 Copy   


  • RRID:Addgene_61342

http://www.addgene.org/61342

Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25019686
Comments: Please note that the mammalian selection marker in the vector backbone for this plasmid has not been verified by sequencing.

Proper citation: RRID:Addgene_61342 Copy   


  • RRID:Addgene_61355

    This resource has 1+ mentions.

http://www.addgene.org/61355

Species: Synthetic
Genetic Insert: S.pyogenes dCas9 with c-terminal HA tag
Vector Backbone Description: Backbone Marker:Invitrogen; Life Technologies; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25849900

Proper citation: RRID:Addgene_61355 Copy   


  • RRID:Addgene_61425

    This resource has 100+ mentions.

http://www.addgene.org/61425

Species: Synthetic
Genetic Insert: dCAS9(D10A, N863A)-VP64_2A_Blast
Vector Backbone Description: Vector Backbone:plenti; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25494202
Comments: IMPORTANT NOTE: If you intend to order the SAM library, this plasmid will come included with that order. Please do NOT order this plasmid if you are already planning to order the SAM library. For additional information, protocols and an activator sgRNA design tool, visit our website: http://sam.genome-engineering.org/

Proper citation: RRID:Addgene_61425 Copy   


  • RRID:Addgene_61389

    This resource has 1+ mentions.

http://www.addgene.org/61389

Species: Synthetic
Genetic Insert: Cer.zf1
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Zebrafish expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25628360

Proper citation: RRID:Addgene_61389 Copy   


  • RRID:Addgene_61388

    This resource has 1+ mentions.

http://www.addgene.org/61388

Species: Synthetic
Genetic Insert: tol1.zf1
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Zebrafish expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25628360

Proper citation: RRID:Addgene_61388 Copy   


  • RRID:Addgene_61422

    This resource has 50+ mentions.

http://www.addgene.org/61422

Species: Synthetic
Genetic Insert: dCAS9(D10A,H840A)-VP64_2A_GFP
Vector Backbone Description: Vector Backbone:lenti(AMP); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25494202
Comments: For additional information, protocols and an activator sgRNA design tool, visit our website: http://sam.genome-engineering.org/

Proper citation: RRID:Addgene_61422 Copy   


  • RRID:Addgene_61390

    This resource has 1+ mentions.

http://www.addgene.org/61390

Species: Synthetic
Genetic Insert: TagRFPT.zf1
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Zebrafish expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25628360

Proper citation: RRID:Addgene_61390 Copy   


  • RRID:Addgene_61392

    This resource has 1+ mentions.

http://www.addgene.org/61392

Species: Synthetic
Genetic Insert: Gal4ff.zf1
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Zebrafish expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25628360

Proper citation: RRID:Addgene_61392 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X