Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 32 showing 621 ~ 640 out of 1,658 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/186392

Vector Backbone Description: Backbone Size:5574; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal mNeonGreen tag at EcoR V/Avr II restriction site

Proper citation: RRID:Addgene_186392 Copy   


http://www.addgene.org/186390

Vector Backbone Description: Backbone Size:5547; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal mEos4b tag at EcoR V/Avr II restriction site

Proper citation: RRID:Addgene_186390 Copy   


http://www.addgene.org/186397

Vector Backbone Description: Backbone Marker:PMID: 17878951; Backbone Size:4650; Vector Backbone:pDEST-pSP172BSSPE-Swa1::RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17878951
Comments: Gateway destination vector for electroporation experiments. Backbone was modified by insertion of tag at SwaI restriction site

Proper citation: RRID:Addgene_186397 Copy   


http://www.addgene.org/186396

Vector Backbone Description: Backbone Marker:PMID: 9043074; Backbone Size:4650; Vector Backbone:Ascidian electroporation vector pSP72-1.27; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17878951
Comments: Gateway destination vector for electroporation experiments. The electroporation vector pSP72-1.27 was modified to give rise to pSP72BSSPE by replacing the NLS-LacZ reporter gene, cloned between BamH1 and EcoR1 by a BamH1-Swa1-Stu1-Pme1-EcoRV-EcoR1 polylinker (GGATCCATTTAAATAGGCCTTTGTTTAAACTTAGATATCGGAATTC).

Proper citation: RRID:Addgene_186396 Copy   


http://www.addgene.org/186395

Vector Backbone Description: Backbone Size:5412; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal Snap-tag tag at EcoR V/Avr II restriction site

Proper citation: RRID:Addgene_186395 Copy   


http://www.addgene.org/186402

Vector Backbone Description: Backbone Marker:PMID: 17878951; Backbone Size:5370; Vector Backbone:pDEST-pSP172BSSPE-Swa1::RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17878951
Comments: Gateway destination vector for electroporation experiments. Backbone was modified by insertion of C terminal ECFP tag at EcoR V restriction site

Proper citation: RRID:Addgene_186402 Copy   


http://www.addgene.org/186400

Vector Backbone Description: Backbone Marker:PMID: 17878951; Backbone Size:5385; Vector Backbone:pDEST-pSP172BSSPE-Swa1::venus-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17878951
Comments: Gateway destination vector for electroporation experiments. Backbone was modified by insertion of N terminal Venus tag at SwaI restriction site

Proper citation: RRID:Addgene_186400 Copy   


http://www.addgene.org/186403

Vector Backbone Description: Backbone Marker:PMID: 17878951; Vector Backbone:pDEST-pSP172BSSPE-Swa1::RfA-ECFP; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17878951
Comments: Gateway destination vector for electroporation experiments. Erroneously annotated in the article PMID 17878951 as pSP72BSSPE-pFOG::RfA-CFP

Proper citation: RRID:Addgene_186403 Copy   


http://www.addgene.org/186378

Vector Backbone Description: Backbone Size:5589; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal mCherry tag at Bgl II/Stu I restriction site

Proper citation: RRID:Addgene_186378 Copy   


  • RRID:Addgene_186375

http://www.addgene.org/186375

Vector Backbone Description: Backbone Marker:PMID: 17878951; Backbone Size:4888; Vector Backbone:pDEST-Spe3-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. This plasmid was obtained by gene synthesis from pDEST-Spe3-RfA by addition of a BglII-ZraI-AatII-StuI-SnaBI (agatctgacgtcaggccttacgta) polylinker before the attR1 sequence and an EcoRV-SacII-AfeI-BstEII-AvrII (gatatcgcggccgcggaagcgctggttacctagg) polylinker after the attR2 sequence.

Proper citation: RRID:Addgene_186375 Copy   


  • RRID:Addgene_186374

http://www.addgene.org/186374

Vector Backbone Description: Backbone Marker:PMID: 17878951; Backbone Size:4915; Vector Backbone:pDEST-Spe3-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17878951
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal HA tag at EcoR V restriction site

Proper citation: RRID:Addgene_186374 Copy   


  • RRID:Addgene_186373

http://www.addgene.org/186373

Vector Backbone Description: Backbone Marker:PMID: 17878951; Backbone Size:4926; Vector Backbone:pDEST-Spe3-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17878951
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal HA tag at Stu I restriction site

Proper citation: RRID:Addgene_186373 Copy   


  • RRID:Addgene_190027

http://www.addgene.org/190027

Vector Backbone Description: Backbone Marker:Stephen Elledge (Addgene #44012); Backbone Size:12546; Vector Backbone:pINDUCER20; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: C terminal mEGFP on backbone

Proper citation: RRID:Addgene_190027 Copy   


http://www.addgene.org/86457

Species: Other
Genetic Insert: BFP
Vector Backbone Description: Backbone Size:3125; Vector Backbone:pBS; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:27729526

Proper citation: RRID:Addgene_86457 Copy   


http://www.addgene.org/186414

Species: E. coli
Genetic Insert: lacZ
Vector Backbone Description: Backbone Marker:PMID: 17878951; Backbone Size:8537; Vector Backbone:pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::B1-NLSLacZ-B2; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17878951
Comments: Gateway destination vector for electroporation experiments.

Proper citation: RRID:Addgene_186414 Copy   


  • RRID:Addgene_188444

http://www.addgene.org/188444

Species: Synthetic
Genetic Insert: REL2N91/ccdB
Vector Backbone Description: Vector Backbone:pGP4G; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:32123041

Proper citation: RRID:Addgene_188444 Copy   


  • RRID:Addgene_188701

    This resource has 1+ mentions.

http://www.addgene.org/188701

Vector Backbone Description: Vector Backbone:pDEST tol2; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:26445458

Proper citation: RRID:Addgene_188701 Copy   


  • RRID:Addgene_188887

http://www.addgene.org/188887

Vector Backbone Description: Vector Backbone:pDEST-P4-P3; Vector Types:Multisite Gateway [4-3] Destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:34748534

Proper citation: RRID:Addgene_188887 Copy   


  • RRID:Addgene_97186

    This resource has 1+ mentions.

http://www.addgene.org/97186

Vector Backbone Description: Backbone Size:10044; Vector Backbone:pFUSE-DEST_R1R4; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:28512244
Comments: Recombine Gene A + Gene B into this Destination vector by Gateway LR reaction to make the final fusion. The pFUSE-A_P1P2 is the same plasmid as Gateway™ pDONR™221 Vector and is commercially available from ThermoFisher Scientific (Cat#: 12536017).

Proper citation: RRID:Addgene_97186 Copy   


  • RRID:Addgene_98142

    This resource has 1+ mentions.

http://www.addgene.org/98142

Vector Backbone Description: Backbone Size:9185; Vector Backbone:pNOC-Flux; Vector Types:Algae, Nannochloropsis; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30883973

Proper citation: RRID:Addgene_98142 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X