Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: rRNA 5'ETS ntds 923 to 1179
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pTOPO; Vector Types:Bacterial Cloning - TOPO; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:15489292
Proper citation: RRID:Addgene_23995 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: 25S rRNA from +5270 to oligo y
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pTOPO; Vector Types:Bacterial Cloning - TOPO; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:15489292
Proper citation: RRID:Addgene_23996 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: rDNA 5'ETS ntds 1 to 177
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pTOPO; Vector Types:Bacterial Cloning - TOPO; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:15489292
Proper citation: RRID:Addgene_23993 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: KAP123
Vector Backbone Description: Backbone Marker:Rosemary Williams (Rout Lab); Backbone Size:7100; Vector Backbone:pYEX-U (modified pYEX-BX); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: KAP123 fused upstream of two FLU tags in BamHI/SalI of pBT024
Proper citation: RRID:Addgene_24048 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: rRNA 5'ETS ntds 347 to 631
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pTOPO; Vector Types:Bacterial Cloning - TOPO; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15489292
Proper citation: RRID:Addgene_23994 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: NAB2
Vector Backbone Description: Backbone Size:9000; Vector Backbone:pYX242; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: NLS of NAB2 (bp 601-750) inserted in EcoRI/BamHI, eGFP inserted downstream in BamHI/HindIII and a single PrA repeat inserted further downstream in HindIII/SalI of pYX242.
PrA motif sequence downstream of GFP:
GCTCAACAAAATGCTTTTTATCAAGTCTTAAATATGCCTAACTTAAATGCTGATCAACGCAATGGTTTTATCCAAAGCCTTAAAGATGATCCAAGCCAAAGTGCTAACGTTTTAGGTGAAGCTCAAAAACTTAATGACTCTCAAGCTCCAAAAGCTGATGCGCAACAAAATAAC
Proper citation: RRID:Addgene_24043 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: PHO4
Vector Backbone Description: Backbone Size:9000; Vector Backbone:pYX242; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: NLS of PHO4 (bp 421-588) inserted in EcoRI/BamHI, eGFP inserted downstream in BamHI/HindIII and a single PrA repeat inserted further downstream in HindIII/SalI of pYX242.
PrA motif sequence downstream of GFP:
GCTCAACAAAATGCTTTTTATCAAGTCTTAAATATGCCTAACTTAAATGCTGATCAACGCAATGGTTTTATCCAAAGCCTTAAAGATGATCCAAGCCAAAGTGCTAACGTTTTAGGTGAAGCTCAAAAACTTAATGACTCTCAAGCTCCAAAAGCTGATGCGCAACAAAATAAC
Proper citation: RRID:Addgene_24044 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: KAP95
Vector Backbone Description: Backbone Marker:Rosemary Williams (Rout Lab); Backbone Size:7100; Vector Backbone:pYEX-U (modified pYEX-BX); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: KAP95 fused upstream of two FLU tags in BamHI/SalI of pBT024
Proper citation: RRID:Addgene_24045 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: pADH1 yeCherry::pTEF1 (Ashbya)yeGFP-DHFR
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pGADT7; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20017217
Proper citation: RRID:Addgene_24585 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: pADH1 yeCherry::pTEF1 (S.C.)yeGFP-DHFR
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pGADT7; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20017217
Comments: The TEF1 (S.C.) promoter region has 4 base differences from the published sequences but the authors report that they do not affect transcriptional function.
Proper citation: RRID:Addgene_24584 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: FAA2
Vector Backbone Description: Backbone Size:0; Vector Backbone:pBR322; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20111002
Proper citation: RRID:Addgene_24631 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yeast Histone H3-2 and Histone H4-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9606197
Comments: HHT2 is Yeast ID YNL031C
HHF2 is Yeast ID YNL030W
HHT2 is gene ID 855700
HHF2 is gene ID 855701
Proper citation: RRID:Addgene_23056 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yeast Histone H3-2 and Histone H4-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9606197
Comments: HHT2 is Yeast ID YNL031C
HHF2 is Yeast ID YNL030W
HHT2 is gene ID 855700
HHF2 is gene ID 855701
Proper citation: RRID:Addgene_23068 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yeast Histone H3-2 and Histone H4-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9606197
Comments: HHT2 is Yeast ID YNL031C
HHF2 is Yeast ID YNL030W
HHT2 is gene ID 855700
HHF2 is gene ID 855701
Proper citation: RRID:Addgene_23064 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yeast Histone H3-2 and Histone H4-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III - Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9606197
Comments: HHT2 is Yeast ID YNL031C
HHF2 is Yeast ID YNL030W
HHT2 is gene ID 855700
HHF2 is gene ID 855701
Proper citation: RRID:Addgene_23065 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yeast Histone H3-2 and Histone H4-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9606197
Comments: HHT2 is Yeast ID YNL031C
HHF2 is Yeast ID YNL030W
HHT2 is gene ID 855700
HHF2 is gene ID 855701
Proper citation: RRID:Addgene_23066 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yeast Histone H3-2 and Histone H4-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12039950
Comments: HHT2 is Yeast ID YNL031C
HHF2 is Yeast ID YNL030W
HHT2 is gene ID 855700
HHF2 is gene ID 855701
Proper citation: RRID:Addgene_23096 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yeast Histone H3-2 and Histone H4-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12039950
Comments: HHT2 is Yeast ID YNL031C
HHF2 is Yeast ID YNL030W
HHT2 is gene ID 855700
HHF2 is gene ID 855701
Proper citation: RRID:Addgene_23097 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Tpa1
Vector Backbone Description: Backbone Size:5443; Vector Backbone:pET21a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20040577
Comments: This construct has a mutation causing N565D in the aa sequence. The depositor does know the effect of this mutation. However, it is not part of the active site.
Proper citation: RRID:Addgene_23140 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yeast Histone H3-2 and Histone H4-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12620224
Comments: HHT2 is Yeast ID YNL031C
HHF2 is Yeast ID YNL030W
HHT2 is gene ID 855700
HHF2 is gene ID 855701
Proper citation: RRID:Addgene_23080 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.