Plasmids   Select Another Resource Report Type

http://www.addgene.org/69550

Species: Synthetic
Genetic Insert: Histone 2B - green fluorescent protein fusion
Vector Backbone Description: Backbone Marker:David Baltimore; Vector Backbone:FUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_69550 Copy   

•   Source: Addgene

http://www.addgene.org/69559

Species: Homo sapiens
Genetic Insert: RPS27A
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3626; Vector Backbone:pET-23a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26235645
Comments: Original sequence encoded human RPS27a. This sequence contains a point mutation (A133G) in order to encode the mouse protein.

Proper citation: RRID:Addgene_69559 Copy   

•   Source: Addgene

http://www.addgene.org/69557

Species: Mus musculus
Genetic Insert: UBB
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3626; Vector Backbone:pET-23a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26235645

Proper citation: RRID:Addgene_69557 Copy   

•   Source: Addgene

http://www.addgene.org/69555

Species: Mus musculus
Genetic Insert: UBC
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3626; Vector Backbone:pET-23a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26235645

Proper citation: RRID:Addgene_69555 Copy   

•   Source: Addgene

http://www.addgene.org/69554

Species: Homo sapiens
Genetic Insert: CYP2C9
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pCW; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Modification of CYP2C9 for bacterial expression as per Barnes et al. PNAS 88:5597, 1991 [PMID: 1829523]: First 8 amino acids of CYP2C cDNAs replaced with those of bovine 17α hydroxylase (MALLLAVF) to optimize bacterial expression.

Proper citation: RRID:Addgene_69554 Copy   

•   Source: Addgene

http://www.addgene.org/69608

Species: Homo sapiens
Genetic Insert: L1PA8
Vector Backbone Description: Backbone Size:3530; Vector Backbone:pBluescript; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22918960
Comments: The ORF1 and ORF2 of the L1PA8 element were commercially synthetically generated and then cloned into the parental pBS-L1PA1CHmneo by swapping the two ORFs.

Proper citation: RRID:Addgene_69608 Copy   

•   Source: Addgene

http://www.addgene.org/69607

Species: Homo sapiens
Genetic Insert: L1PA4
Vector Backbone Description: Backbone Size:3530; Vector Backbone:pBluescript; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22918960
Comments: The ORF1 and ORF2 of the L1PA4 element were commercially synthetically generated and then cloned into the parental pBS-L1PA1CHmneo by swapping the two ORFs.

Proper citation: RRID:Addgene_69607 Copy   

•   Source: Addgene

http://www.addgene.org/69606

Species: Homo sapiens
Genetic Insert: CYP2C19
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pCW; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Modification of CYP2C19 for bacterial expression as per Barnes et al. PNAS 88:5597, 1991 [PMID: 1829523]: First 8 amino acids of CYP2C cDNAs replaced with those of bovine 17α hydroxylase (MALLLAVF) to optimize bacterial expression.

Proper citation: RRID:Addgene_69606 Copy   

•   Source: Addgene

http://www.addgene.org/69560

Species: Homo sapiens
Genetic Insert: UBA52
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3626; Vector Backbone:pET-23a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26235645
Comments: Human and mouse UBA52 are identical at protein level.

Proper citation: RRID:Addgene_69560 Copy   

•   Source: Addgene

http://www.addgene.org/69604

Species: Homo sapiens
Genetic Insert: CYP2C8
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pCW; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Modification of CYP2C8 for bacterial expression as per Barnes et al. PNAS 88:5597, 1991 [PMID: 1829523]: First 8 amino acids of CYP2C cDNAs replaced with those of bovine 17α hydroxylase (MALLLAVF) to optimize bacterial expression. An XbaI site was placed after the stop codon The insert was ligated into NdeI and XBbaI cut pCW ori+.

Proper citation: RRID:Addgene_69604 Copy   

•   Source: Addgene

http://www.addgene.org/69569

Species: Mus musculus
Genetic Insert: TCR beta
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KS; Vector Types:Bacterial Expression, Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1419956
Comments: Insert is a 14.5 kb fragment containing the TCR beta-chain coding and promoter regions but lacking the 3' TCR beta-chain enhancer.

Proper citation: RRID:Addgene_69569 Copy   

•   Source: Addgene

http://www.addgene.org/69602

Species: Mus musculus
Genetic Insert: Runx1 +23 intronic enhancer
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4777; Vector Backbone:pENTR attL4-R1; Vector Types:5' Gateway Entry Vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25594182
Comments: All PCR was performed using the High Fidelity Advantage 2 PCR Kit (Clontech). The Runx1 +23 enhancer (1) was PCR amplified from C57/BL6 mouse genomic DNA using the following primers: Forward (XhoI and BamHI sites added) 5’-GGCTCGAGGGATCCGGGGTGGGAGGTGTAAGTTC-3’ and Reverse (BglII and NotI sites added) 5’- GGGCGGCCGCAGATCTCAGGTGTCAGCAACCCATC -3’. The PCR fragment was gel purified, XhoI/BglII digested, ligated into XhoI/BamHI digested Tol2kit (2) #228 p5E-MCS vector and sequence verified. The mouse beta-globin minimal promoter was PCR amplified from C57/BL6 mouse genomic DNA using the following primers: Forward (SpeI site added) 5’-GGACTAGTCCAATCTGCTCAGAGAGGACA-3’ and Reverse (SacII site added) 5’-GGCCGCGGGATGTCTGTTTCTGAGGTTGC-3’. The beta-globin minimal promoter and Runx1+23 5’ entry vector were SpeI/SacII digested and ligated together. Multisite Gateway reactions were performed according to the Invitrogen protocol. 1. Nottingham, W. T., Jarratt, A., Burgess, M., Speck, C. L., Cheng, J.-F., Prabhakar, S., et al. (2007). Runx1-mediated hematopoietic stem-cell emergence is controlled by a Gata/Ets/SCL-regulated enhancer. Blood, 110(13), 4188–4197. http://doi.org/10.1182/blood-2007-07-100883 2. Kwan, K. M., Fujimoto, E., Grabher, C., Mangum, B. D., Hardy, M. E., Campbell, D. S., et al. (2007). The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs. Developmental Dynamics : an Official Publication of the American Association of Anatomists, 236(11), 3088–3099. http://doi.org/10.1002/dvdy.21343

Proper citation: RRID:Addgene_69602 Copy   

•   Source: Addgene

http://www.addgene.org/69600

Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pBluescript KS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9553774
Comments: A 1.0 kb Sma-I/Not-I fragment containing the TCR b-chain enhancer element was excised from pKS913.Cb18.31 and cloned into the pKS Bluescript plasmid (Stratagene), which had been modified to remove the Kpn-I and Cla-I restriction sites from the polylinker resulting in the pKS.bEnh plasmid. A Sal-I fragment, containing the B3 TCR b-chain enhancer, promoter and coding regions, was isolated from pKS913.Cb18.31 and cloned into the Sal-I site of the pKS.bEnh plasmid to give the construct pKS913.Cb18.31(Kpn-I)/Cla-I)). A 4.2 kb Eco-I/Cla-I fragment comprising the 5’ region and leader sequence from the hybridoma 2B4 was isolated from the p3A9 b shuttle vector. This fragment was cloned into the pGEM-T plasmid (Promega) resulting in the pG3A9 plasmid. A 4.2 kb Apa-I/Cla-I fragment, containing the 2B4 5’ region and leader sequence, was isolated from the pG3A9 plasmid. This fragment was cloned into pKS319.Cb18.31(Kpn-I)/Cla-I)) after removal of the B3 TCR b-chain promoter and the TCRBVDJ coding regions by a combined Apa-I/Cla-I restriction enzyme digest, resulting in the p3A9cbTCR plasmid.

Proper citation: RRID:Addgene_69600 Copy   

•   Source: Addgene

http://www.addgene.org/69738

Species: Homo sapiens
Genetic Insert: CENP-R
Vector Backbone Description: Vector Backbone:pJAG98 (pBABEblast); Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_69738 Copy   

•   Source: Addgene

http://www.addgene.org/69737

Species: Homo sapiens
Genetic Insert: Bod1
Vector Backbone Description: Vector Backbone:pJAG98 (pBABEblast); Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_69737 Copy   

•   Source: Addgene

http://www.addgene.org/69694

Species: Other
Genetic Insert: dnaQ926 dam seqA emrR ugi AID(Mut7.3)
Vector Backbone Description: Backbone Marker:David Liu Lab; Backbone Size:2992; Vector Backbone:CloDF13; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:26443021
Comments: The authors strongly recommend that all MP-carrying strains be maintained in rich media supplemented by 25 mM glucose. The expression of the MP-borne mutators is regulated by the E. coli arabinose pBAD promoter, which is efficiently repressed at high concentrations of glucose. Please consult Badran and Liu, Nature Communications (2015) for more detailed strain maintenance protocols.

Proper citation: RRID:Addgene_69694 Copy   

•   Source: Addgene

http://www.addgene.org/69692

Species: Other
Genetic Insert: dnaQ926 d80-AAG(Y127I-H136L)
Vector Backbone Description: Backbone Marker:David Liu Lab; Backbone Size:2992; Vector Backbone:CloDF13; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:26443021
Comments: The authors strongly recommend that all MP-carrying strains be maintained in rich media supplemented by 25 mM glucose. The expression of the MP-borne mutators is regulated by the E. coli arabinose pBAD promoter, which is efficiently repressed at high concentrations of glucose. Please consult Badran and Liu, Nature Communications (2015) for more detailed strain maintenance protocols.

Proper citation: RRID:Addgene_69692 Copy   

•   Source: Addgene

http://www.addgene.org/69691

Species: Other
Genetic Insert: dnaQ926 AAG(Y127I-H136L)
Vector Backbone Description: Backbone Marker:David Liu Lab; Backbone Size:2992; Vector Backbone:CloDF13; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:26443021
Comments: The authors strongly recommend that all MP-carrying strains be maintained in rich media supplemented by 25 mM glucose. The expression of the MP-borne mutators is regulated by the E. coli arabinose pBAD promoter, which is efficiently repressed at high concentrations of glucose. Please consult Badran and Liu, Nature Communications (2015) for more detailed strain maintenance protocols.

Proper citation: RRID:Addgene_69691 Copy   

•   Source: Addgene

http://www.addgene.org/69690

Species: Other
Genetic Insert: dnaQ926 MAG1
Vector Backbone Description: Backbone Marker:David Liu Lab; Backbone Size:2992; Vector Backbone:CloDF13; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:26443021
Comments: The authors strongly recommend that all MP-carrying strains be maintained in rich media supplemented by 25 mM glucose. The expression of the MP-borne mutators is regulated by the E. coli arabinose pBAD promoter, which is efficiently repressed at high concentrations of glucose. Please consult Badran and Liu, Nature Communications (2015) for more detailed strain maintenance protocols.

Proper citation: RRID:Addgene_69690 Copy   

•   Source: Addgene

http://www.addgene.org/69736

Species: Homo sapiens
Genetic Insert: PELP1
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_69736 Copy   

•   Source: Addgene