Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

745,085 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Authority

Sort Ascending

Sort Descending

 Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pGL2 enhancer- F6 LUC
 
Resource Report
Resource Website 		RRID:Addgene_22438 F6 Homo sapiens Ampicillin PMID:7541039 Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:07:37 0
pGL2 enhancer- F6 Sp-1 mut
 
Resource Report
Resource Website 		RRID:Addgene_22439 F6 Sp-1 mut Homo sapiens Ampicillin PMID:7541039 Sp1 mutation (−103) oligo is - GGATAGGGACTGGGCGAGG Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:07:37 0
pGL2 enhancer- F4 LUC
 
Resource Report
Resource Website 		RRID:Addgene_22434 F4 Homo sapiens Ampicillin PMID:7541039 Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:07:37 0
pGL2 enhancer- F4 GATA mut
 
Resource Report
Resource Website 		RRID:Addgene_22435 F4 GATA mut Homo sapiens Ampicillin PMID:7541039 GATA mutation oigo - GCTCCCACTTTAGAGCCTCAGT Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:07:37 0
pGL2 enhancer- F5 LUC
 
Resource Report
Resource Website 		RRID:Addgene_22436 F5 Homo sapiens Ampicillin PMID:7541039 Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:07:37 0
pGL2 enhancer- F3 GATA Sp-1 mut
 
Resource Report
Resource Website 		RRID:Addgene_22431 F3 GATA Sp-1 mut Homo sapiens Ampicillin PMID:7541039 The forward primer used for the Sp1 mutations (-103) was GGATAGGGACTGGGCGAGG. GATA mutation oigo - GCTCCCACTTTAGAGCCTCAGT. Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:07:37 0
pGL2 enhancer- F3 Sp-1 mut
 
Resource Report
Resource Website 		RRID:Addgene_22432 F3 Sp-1 mut Homo sapiens Ampicillin PMID:7541039 Forward primer used to create Sp-1 mutation: GGATAGGGACTGGGCGAGG Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:07:37 0
pJB008
 
Resource Report
Resource Website 		RRID:Addgene_22647 Human genomic PLP Homo sapiens Ampicillin PMID:2479017 Genomic DNA from an EMBL3 human genomic library. Contains 3' end of Exon1, Intron 1, Exon 2 and Intron 2 Backbone Marker:Fermentas; Backbone Size:2862; Vector Backbone:pTZ19R; Vector Types:phagemid; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:07:39 0
pR-BAM
 
Resource Report
Resource Website 		RRID:Addgene_22649 Myelin Transcription Factor 1L Rattus norvegicus Ampicillin PMID:9373037 Used to make riboprobes by cutting with SmaI and transcribing with SP6 polymerase to give a 980 bp riboprobe for RNA analysis on Northern blots This Rat Myt1 DNA cloned by Hudson lab. Backbone Marker:Promega; Backbone Size:2743; Vector Backbone:pGEM-3Z; Vector Types:Cloning and RNA Synthesis; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:07:39 0
Flag-HA-BAP1
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_22539 BAP1 Homo sapiens Ampicillin PMID:19615732 Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin None Addgene 2026-10-31 02:07:38 10
pLH116
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22651 Proteolipid Protein Mus musculus Ampicillin PMID:3469678 Contains entire coding region of the mouse PLP cDNA including part of the 5' UTR. Used to make riboprobes by transcribing with SP6 polymerase to give a 980 bp antisense riboprobe or transcribing with T7 polymerase to give a 980bp sense riboprobe for RNA analysis on Northern blots. This PLP DNA cloned by Hudson lab. Backbone Marker:Promega; Backbone Size:2867; Vector Backbone:pGEM3; Vector Types:cloning vector; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:07:39 2
pEF1a-mRor2deltaIg
 
Resource Report
Resource Website 		RRID:Addgene_22629 Ror2 delta Ig Mus musculus Ampicillin PMID:19720827 Backbone Size:9226; Vector Backbone:pEF1a-myc/his A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Deletion of Ig domain Addgene 2026-10-31 02:07:39 0
pJB036
 
Resource Report
Resource Website 		RRID:Addgene_22624 human genomic PLP promoter region Homo sapiens Ampicillin PMID:1378839 Insert is 4200bp (approx) of the Human PLP 5' upstream, promoter region and Exon1 (-4200 to +85) in the correct orientation. Insert is a BamHI/HindIII from pJB010 This PLP DNA cloned by Hudson lab. Backbone Marker:R. McKinnon; Backbone Size:4728; Vector Backbone:p18CAT; Vector Types:CAT reporter plasmid; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:07:39 0
pJB038
 
Resource Report
Resource Website 		RRID:Addgene_22625 human genomic PLP promoter region Homo sapiens Ampicillin PMID:1378839 Insert is 30bp ) of the Human PLP 5' upstream, promoter region and Exon1 (-18 to +12) in the correct orientation. This PLP DNA cloned by Hudson lab. Backbone Marker:R. McKinnon; Backbone Size:4728; Vector Backbone:p18CAT; Vector Types:CAT reporter plasmid; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:07:39 0
pJB041
 
Resource Report
Resource Website 		RRID:Addgene_22626 human genomic PLP promoter region Homo sapiens Ampicillin PMID:1378839 Insert is 1200bp (approx) of the Human PLP 5' upstream, promoter region and Exon1 (-1088 to +85) in the correct orientation. Site 3 (bp -117 to -116) were mutated via Site-Directed Mutagenesis from GG to cc. This PLP DNA cloned by Hudson lab. Backbone Marker:R. McKinnon; Backbone Size:4728; Vector Backbone:p18CAT; Vector Types:CAT reporter plasmid; Bacterial Resistance:Ampicillin Site 3 mutation -117 to -116bp GG to cc Addgene 2026-10-31 02:07:39 0
Flag-HA-USP50
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22588 USP50 Homo sapiens Ampicillin PMID:19615732 Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin None Addgene 2026-10-31 02:07:39 2
pJB032
 
Resource Report
Resource Website 		RRID:Addgene_22623 human genomic PLP promoter region Homo sapiens Ampicillin PMID:1378839 Insert is 1200bp (approx) of the Human PLP 5' upstream, promoter region and Exon1 (-1088 to +85) in the correct orientation This PLP DNA cloned by Hudson lab. Backbone Marker:R. McKinnon; Backbone Size:4728; Vector Backbone:p18CAT; Vector Types:CAT reporter plasmid; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:07:39 0
Flag-HA-USP46
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22584 USP46 Homo sapiens Ampicillin PMID:19615732 Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin None Addgene 2026-10-31 02:07:39 1
Flag-HA-USP48
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22585 USP48 Homo sapiens Ampicillin PMID:19615732 Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin None Addgene 2026-10-31 02:07:39 4
Flag-HA-USP38
 
Resource Report
Resource Website 		RRID:Addgene_22580 USP38 Homo sapiens Ampicillin PMID:19615732 Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin None Addgene 2026-10-31 02:07:38 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join the NIDDK-CR Webinar "Pixels to Phenotypes – Whole Slide Imaging Pathomics” on October 28, 2026

dkNET Webinar: Gene Regulatory Network Analysis in Texera

dkNET Webinar: A Hormone Cell Atlas Maps the Human Endocrine System at Cellular Resolution

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch