Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:rattus norvegicus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

2,177 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pcDNA3-ALK7 wt
 
Resource Report
Resource Website 		RRID:Addgene_80885 ALK7 Rattus norvegicus Ampicillin PMID:10980615 Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:20:42 0
AAV_pMBP-dnVamp3-P2AT2A-EGFP-caax
 
Resource Report
Resource Website 		RRID:Addgene_190154 Vamp3 Rattus norvegicus Ampicillin PMID:36151203 Uribina...& Gupton; PMID: 29351997 Gow...& Lazzarini; PMID:1383235 Pan... & Musacchio; PMID: 28059702. Please visit https://www.biorxiv.org/content/10.1101/2022.07.08.498895v1 for bioRxiv preprint. Backbone Marker:Zuchero lab; Backbone Size:4561; Vector Backbone:pBZ-167 AAV CMV promoter base vector; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin Truncation that includes only rat Vamp3 AA #1-81 2026-08-15 01:24:25 0
pCMV-Vamp3-pHluorin
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_190152 Vamp3 Rattus norvegicus Ampicillin PMID:36151203 Vamp3-pHluorin was cloned from a construct kindly provided by Prof. Stephanie Gupton, from this paper: PMID: 29351997. Please visit https://www.biorxiv.org/content/10.1101/2022.07.08.498895v1 for bioRxiv preprint. Backbone Marker:Zuchero lab; Backbone Size:4561; Vector Backbone:pBZ-167 AAV CMV promoter base vector; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:24:25 1
pEF Synaptophysin-GCamp6s
 
Resource Report
Resource Website 		RRID:Addgene_188981 Synaptophysin Rattus norvegicus Ampicillin PMID:29754754 Vector Backbone:pEF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:24:28 0
CMV mRuby3-Synapsin1a
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_187896 Synapsin1a Rattus norvegicus Kanamycin F255Y and S304A mutations in Synapsin1a insert do not affect plasmid function. Backbone Marker:Clontech, Palo Alto, California; Backbone Size:3998; Vector Backbone:pEGFP-C1 vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:23:22 3
pN1-RnKIF5C(1-560)-Halo-Flag
 
Resource Report
Resource Website 		RRID:Addgene_188071 rat KIF5C Rattus norvegicus Kanamycin PMID:35504282 Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin aa1-560 2026-08-15 01:23:26 0
pN1-RnKIF5C(1-560,Δ6)-Halo-Flag
 
Resource Report
Resource Website 		RRID:Addgene_188072 rat KIF5C Rattus norvegicus Kanamycin PMID:35504282 Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin aa1-560, deletion of aa2-6 2026-08-15 01:23:26 0
EGFP-Myo1b
 
Resource Report
Resource Website 		RRID:Addgene_187362 myosin 1b isoform b Rattus norvegicus Kanamycin PMID:10233157 The expression of the recombinant plasmid includes the addition of 18 amino acids (SGLRSRAQASNSDPRYPP) between GFP and Myo1b. Backbone Marker:Clontech; Backbone Size:4752; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:23:29 0
Cherry-Myo1b
 
Resource Report
Resource Website 		RRID:Addgene_187366 myosin 1b isoform b Rattus norvegicus Kanamycin PMID:29588377 The expression of the recombinant plasmid includes the addition of 18 amino acids (SGLRSRAQASNSDPRYPP) between Cherry and Myo1b. Backbone Marker:Clontech; Backbone Size:4743; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:23:29 0
EGFP-Myo1b-Tail
 
Resource Report
Resource Website 		RRID:Addgene_187365 myosin 1b isoform b Tail domain Rattus norvegicus Kanamycin PMID:26195670 PCR cloning at BglII-SalI DNA fragment was generated by PCR on rat Myo1b cDNA with 5' primer TTGGCCATCAAGACCTTACCTA and 3' primer CCTCACTTAAGGGACAGCGACTT Backbone Marker:Clontech; Backbone Size:4713; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:23:29 0
EGFP-Myo1-IQ-Tail
 
Resource Report
Resource Website 		RRID:Addgene_187363 myosin 1b isoform b IQTail domain Rattus norvegicus Kanamycin PMID:10233157 The expression of the recombinant plasmid includes the addition of 18 amino acids (SGLRSRAQASNSDPRYPP) between GFP and Myo1b. Cloning by deletion of the fragment EcoRV-EcoRV from the recombinant plasmid encoding GFP-Myo1b. Backbone Marker:Clontech; Backbone Size:4743; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:23:30 0
Stx3
 
Resource Report
Resource Website 		RRID:Addgene_186685 Syntaxin 3 Rattus norvegicus Ampicillin PMID:35322233 Vector Backbone:pTEV5; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:23:30 0
GLT-1b delta 4
 
Resource Report
Resource Website 		RRID:Addgene_98707 Glt1b Rattus norvegicus Ampicillin Please note that mutations I521V and N538Y in Glt1b (reference AF451299) were found during Addgene's quality control. The depositor noted that these mutations do NOT affect plasmid function. Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin missing last 4 amino acids at the C-terminus. I521V and N538Y (please see depositor comments section below) 2026-08-15 01:22:42 0
pLV-shIl22ra2-1408
 
Resource Report
Resource Website 		RRID:Addgene_99032 Il22ra2 Rattus norvegicus Ampicillin PMID:25585681 This plasmid was generated as part of the NIAAA-funded INIA consortium. Backbone Size:7649; Vector Backbone:pLL3.7; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:22:44 0
pCI-Neo-p53mut
 
Resource Report
Resource Website 		RRID:Addgene_99239 p53 Rattus norvegicus Ampicillin PMID:9278438 Addgene's QC result finds an additional K318E mutation, which the depositor notes should have no functional consequence as it is away from the dimerization and DNA binding motifs Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-Neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Silent mutations in translated protein at Gly (103) Ser and Glu (256) Gly. 2026-08-15 01:22:44 0
pcDNA-Evf2
 
Resource Report
Resource Website 		RRID:Addgene_99478 Evf2 Rattus norvegicus Ampicillin PMID:16705037 Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:22:45 0
pOC2 GFP-Mpp2 KI
 
Resource Report
Resource Website 		RRID:Addgene_183434 gRNA and GFP donor Rattus norvegicus Ampicillin PMID:35851300 Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint. Vector Backbone:pOC2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:22:51 0
pOC2 GFP-Actb KI
 
Resource Report
Resource Website 		RRID:Addgene_183429 gRNA and GFP donor Rattus norvegicus Ampicillin PMID:35851300 Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint. Vector Backbone:pOC2; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:22:51 0
pOC1 Halo-Actb KI
 
Resource Report
Resource Website 		RRID:Addgene_183426 gRNA and Halo donor Rattus norvegicus Ampicillin PMID:35851300 Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint. Vector Backbone:pOC1; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:22:51 0
pCAG-IRES2-p75NTR-GFP
 
Resource Report
Resource Website 		RRID:Addgene_182947 p75NTR-mGFP Rattus norvegicus Ampicillin Backbone Size:7245; Vector Backbone:pCAG-IRES2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin The leader sequence is from preprotrypin 2026-08-15 01:22:51 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch